Incidental Mutation 'R2136:Adgrl3'
ID235801
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Nameadhesion G protein-coupled receptor L3
SynonymsLEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location81020138-81825133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81512254 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 290 (K290R)
Ref Sequence ENSEMBL: ENSMUSP00000113249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000120673] [ENSMUST00000121641] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000132375]
Predicted Effect probably damaging
Transcript: ENSMUST00000036068
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072521
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117253
AA Change: K222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117407
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117985
AA Change: K222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118034
AA Change: K222R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118078
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118442
AA Change: K290R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119385
AA Change: K290R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119788
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120128
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120144
AA Change: K222R

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120292
AA Change: K222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120445
AA Change: K290R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120673
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121641
AA Change: K290R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121707
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122037
AA Change: K222R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: K222R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122356
AA Change: K290R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: K290R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127046
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153264
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81724224 missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81646467 missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81794568 missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81693554 missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81693574 missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81560893 missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81726723 missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81688669 missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81465287 missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81694569 missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81387870 missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81465296 missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81512217 missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81512581 missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81512119 missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81792403 missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81771685 splice site probably benign
R0103:Adgrl3 UTSW 5 81792347 intron probably benign
R0138:Adgrl3 UTSW 5 81693607 missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0349:Adgrl3 UTSW 5 81771644 missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81726801 missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81693716 splice site probably benign
R0658:Adgrl3 UTSW 5 81648713 missense probably benign 0.18
R0671:Adgrl3 UTSW 5 81560905 missense probably benign 0.45
R0679:Adgrl3 UTSW 5 81794977 missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81512353 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81387979 missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81794420 missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81771617 nonsense probably null
R1891:Adgrl3 UTSW 5 81512044 missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81688567 missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81512536 missense probably damaging 1.00
R2171:Adgrl3 UTSW 5 81512515 nonsense probably null
R2891:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81724256 missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81694526 missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81512544 missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81688510 missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81766205 missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81646578 missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81760724 missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81766234 missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81794271 missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81689646 missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81512110 missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81512048 missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81646551 missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81726669 missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81726801 missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81465341 intron probably benign
R5482:Adgrl3 UTSW 5 81794513 missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81724147 missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81693544 missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81646570 missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81512326 missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81646522 missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81688563 missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81688556 missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81726870 missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81794494 nonsense probably null
R6516:Adgrl3 UTSW 5 81465272 missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81787517 missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81794759 missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81741080 missense probably damaging 1.00
R6902:Adgrl3 UTSW 5 81689587 missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81648713 missense probably damaging 0.99
Z1088:Adgrl3 UTSW 5 81329882 missense probably benign 0.33
Z1088:Adgrl3 UTSW 5 81512158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACCCTCTACAGGCTTC -3'
(R):5'- TGTAAGGGTTCAACTGGCTAATG -3'

Sequencing Primer
(F):5'- CCTCTACAGGCTTCTGACAAG -3'
(R):5'- GGGTTCAACTGGCTAATGACAATC -3'
Posted On2014-10-01