Incidental Mutation 'R2136:Fat3'
ID235824
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene NameFAT atypical cadherin 3
Synonyms9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
MMRRC Submission 040139-MU
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15910189-16501285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16377051 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 392 (I392T)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
Predicted Effect probably benign
Transcript: ENSMUST00000082170
AA Change: I392T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: I392T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217308
AA Change: I392T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15996427 missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15915519 missense probably benign 0.14
IGL00966:Fat3 APN 9 15999094 missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16375228 missense probably damaging 1.00
IGL01104:Fat3 APN 9 16375728 missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15998460 missense probably damaging 1.00
IGL01121:Fat3 APN 9 15998401 missense probably benign 0.00
IGL01407:Fat3 APN 9 16378023 missense probably benign 0.01
IGL01444:Fat3 APN 9 15998848 missense probably damaging 1.00
IGL01634:Fat3 APN 9 15998358 missense probably damaging 1.00
IGL01649:Fat3 APN 9 16376719 missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15997872 missense probably damaging 1.00
IGL01867:Fat3 APN 9 16377901 missense probably benign 0.03
IGL01894:Fat3 APN 9 16375849 missense probably benign
IGL01913:Fat3 APN 9 15998790 missense probably damaging 0.99
IGL02033:Fat3 APN 9 15915352 missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16377970 missense probably benign 0.06
IGL02146:Fat3 APN 9 15999582 missense probably benign
IGL02147:Fat3 APN 9 15995985 missense probably damaging 1.00
IGL02161:Fat3 APN 9 15997050 missense probably benign 0.10
IGL02161:Fat3 APN 9 15997051 nonsense probably null
IGL02164:Fat3 APN 9 16031424 splice site probably benign
IGL02269:Fat3 APN 9 15915577 missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15969838 missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15988412 nonsense probably null
IGL02410:Fat3 APN 9 15997845 missense probably damaging 1.00
IGL02504:Fat3 APN 9 15959798 missense probably damaging 1.00
IGL02572:Fat3 APN 9 15960506 missense probably benign
IGL02623:Fat3 APN 9 15997137 missense probably damaging 1.00
IGL02654:Fat3 APN 9 15996975 missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16006711 missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16376850 missense probably damaging 1.00
IGL02839:Fat3 APN 9 15919170 missense probably damaging 1.00
IGL02890:Fat3 APN 9 15915340 missense probably benign 0.03
IGL02892:Fat3 APN 9 16377562 missense probably damaging 1.00
IGL03090:Fat3 APN 9 16377239 nonsense probably null
IGL03144:Fat3 APN 9 16375245 missense probably damaging 1.00
IGL03199:Fat3 APN 9 16377048 missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15996469 missense probably damaging 1.00
IGL03392:Fat3 APN 9 16003862 missense probably benign
IGL03408:Fat3 APN 9 15997957 nonsense probably null
gagged UTSW 9 15998271 missense probably damaging 1.00
Muffled UTSW 9 15937991 critical splice donor site probably null
softened UTSW 9 16378185 missense probably benign
F6893:Fat3 UTSW 9 16006789 missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15996600 missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15992118 critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 16006601 missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16376808 missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15996316 missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15996351 missense probably benign 0.06
R0001:Fat3 UTSW 9 16377873 missense probably damaging 0.99
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0038:Fat3 UTSW 9 15915010 missense probably damaging 1.00
R0046:Fat3 UTSW 9 15965979 missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15938205 missense probably benign
R0135:Fat3 UTSW 9 16006777 missense probably damaging 1.00
R0255:Fat3 UTSW 9 15969706 splice site probably benign
R0349:Fat3 UTSW 9 16031180 missense probably damaging 1.00
R0361:Fat3 UTSW 9 15998403 missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15959756 missense probably damaging 1.00
R0418:Fat3 UTSW 9 16246896 missense probably damaging 1.00
R0419:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R0437:Fat3 UTSW 9 15996932 missense probably damaging 1.00
R0441:Fat3 UTSW 9 15945008 splice site probably benign
R0480:Fat3 UTSW 9 15997729 missense probably benign 0.00
R0510:Fat3 UTSW 9 15999685 nonsense probably null
R0665:Fat3 UTSW 9 15997402 missense probably benign
R0715:Fat3 UTSW 9 16375123 missense probably benign
R0727:Fat3 UTSW 9 15996699 missense probably damaging 1.00
R0882:Fat3 UTSW 9 16031368 missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15997804 missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15970034 missense probably benign
R1081:Fat3 UTSW 9 16375284 missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16006615 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1233:Fat3 UTSW 9 15922745 missense probably benign
R1306:Fat3 UTSW 9 16376679 missense probably damaging 1.00
R1311:Fat3 UTSW 9 16021410 missense probably damaging 1.00
R1338:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1395:Fat3 UTSW 9 16246916 missense probably benign 0.00
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1510:Fat3 UTSW 9 15960055 missense probably damaging 1.00
R1528:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1531:Fat3 UTSW 9 15997465 missense probably damaging 1.00
R1659:Fat3 UTSW 9 15997183 missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15944880 missense probably benign 0.05
R1699:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R1728:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15995937 missense probably benign
R1784:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16376985 missense probably benign 0.00
R1794:Fat3 UTSW 9 15997136 nonsense probably null
R1794:Fat3 UTSW 9 15997138 missense probably benign 0.15
R1830:Fat3 UTSW 9 15915340 missense probably benign 0.03
R1835:Fat3 UTSW 9 15998088 missense probably damaging 1.00
R1887:Fat3 UTSW 9 15967061 missense probably damaging 1.00
R1898:Fat3 UTSW 9 15960130 missense probably damaging 1.00
R1909:Fat3 UTSW 9 15998115 missense probably benign
R1912:Fat3 UTSW 9 15969988 missense probably damaging 1.00
R1917:Fat3 UTSW 9 15997057 missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15968295 missense probably benign 0.00
R2070:Fat3 UTSW 9 15999370 missense probably benign 0.21
R2100:Fat3 UTSW 9 16377430 missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15998517 missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15999786 missense probably damaging 1.00
R2132:Fat3 UTSW 9 16246719 critical splice donor site probably null
R2146:Fat3 UTSW 9 15990512 missense probably benign 0.01
R2233:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2234:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2273:Fat3 UTSW 9 15915262 missense probably benign
R2285:Fat3 UTSW 9 16376173 missense probably damaging 1.00
R2363:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2365:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2367:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2403:Fat3 UTSW 9 15969871 missense probably damaging 1.00
R2447:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2496:Fat3 UTSW 9 15966103 missense probably benign 0.01
R2509:Fat3 UTSW 9 15925014 missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16375944 missense probably damaging 1.00
R2986:Fat3 UTSW 9 15992128 missense probably damaging 1.00
R3054:Fat3 UTSW 9 15960496 missense probably benign
R3056:Fat3 UTSW 9 15960496 missense probably benign
R3729:Fat3 UTSW 9 16247041 splice site probably benign
R3745:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3806:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3859:Fat3 UTSW 9 15997228 nonsense probably null
R3862:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3890:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3892:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3950:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3972:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4004:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4005:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4086:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4111:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4113:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4227:Fat3 UTSW 9 16377693 missense probably damaging 1.00
R4352:Fat3 UTSW 9 16246778 missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15922792 missense probably benign 0.11
R4403:Fat3 UTSW 9 15944873 missense probably damaging 1.00
R4433:Fat3 UTSW 9 16031152 missense probably damaging 0.99
R4453:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4479:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4480:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4521:Fat3 UTSW 9 15922942 missense probably null 0.71
R4620:Fat3 UTSW 9 15996894 missense probably damaging 1.00
R4700:Fat3 UTSW 9 16031173 missense probably damaging 1.00
R4721:Fat3 UTSW 9 16029966 missense probably damaging 1.00
R4790:Fat3 UTSW 9 15998484 missense probably damaging 1.00
R4796:Fat3 UTSW 9 15999732 missense probably benign 0.17
R4823:Fat3 UTSW 9 15996507 missense probably benign
R4836:Fat3 UTSW 9 16377723 missense probably damaging 1.00
R4842:Fat3 UTSW 9 15997587 missense probably damaging 1.00
R4849:Fat3 UTSW 9 16377948 missense probably benign 0.03
R4856:Fat3 UTSW 9 16021330 missense probably benign
R4869:Fat3 UTSW 9 16377477 missense probably damaging 0.98
R4886:Fat3 UTSW 9 16021330 missense probably benign
R4899:Fat3 UTSW 9 15969799 missense probably damaging 1.00
R4941:Fat3 UTSW 9 16375152 missense probably damaging 1.00
R4986:Fat3 UTSW 9 15998340 missense probably damaging 1.00
R5058:Fat3 UTSW 9 15996858 missense probably damaging 1.00
R5079:Fat3 UTSW 9 15999127 missense probably benign 0.01
R5080:Fat3 UTSW 9 15999338 missense probably benign 0.35
R5174:Fat3 UTSW 9 15999570 missense probably damaging 1.00
R5183:Fat3 UTSW 9 15960313 missense probably damaging 0.99
R5203:Fat3 UTSW 9 16378142 missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16377537 missense probably damaging 1.00
R5230:Fat3 UTSW 9 15990560 missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16376629 missense probably damaging 1.00
R5377:Fat3 UTSW 9 16376443 missense probably benign 0.05
R5385:Fat3 UTSW 9 15922675 missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15960514 missense probably benign 0.02
R5437:Fat3 UTSW 9 16085308 missense probably damaging 1.00
R5453:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R5460:Fat3 UTSW 9 15919167 missense probably damaging 1.00
R5516:Fat3 UTSW 9 15998709 missense probably damaging 1.00
R5568:Fat3 UTSW 9 16376923 nonsense probably null
R5628:Fat3 UTSW 9 15966096 missense probably damaging 1.00
R5835:Fat3 UTSW 9 16375833 missense probably damaging 1.00
R5845:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R5898:Fat3 UTSW 9 15938461 missense probably benign 0.15
R5941:Fat3 UTSW 9 15999501 missense probably benign 0.07
R5974:Fat3 UTSW 9 16006528 critical splice donor site probably null
R5986:Fat3 UTSW 9 15998317 missense probably benign 0.22
R6015:Fat3 UTSW 9 16376050 missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6042:Fat3 UTSW 9 16377817 missense probably benign 0.12
R6051:Fat3 UTSW 9 16375455 missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15922679 missense probably null
R6119:Fat3 UTSW 9 16376568 missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16377522 missense probably damaging 1.00
R6254:Fat3 UTSW 9 15996145 missense probably benign 0.19
R6318:Fat3 UTSW 9 15916984 intron probably benign
R6347:Fat3 UTSW 9 15998372 missense probably damaging 1.00
R6348:Fat3 UTSW 9 15937991 critical splice donor site probably null
R6351:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R6450:Fat3 UTSW 9 15999170 missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15967000 missense probably damaging 1.00
R6524:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R6533:Fat3 UTSW 9 15998899 missense probably benign 0.02
R6565:Fat3 UTSW 9 15915327 missense probably benign
R6576:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R6649:Fat3 UTSW 9 16376742 missense probably damaging 1.00
R6716:Fat3 UTSW 9 15919269 missense probably benign
R6719:Fat3 UTSW 9 15996144 missense probably benign
R6753:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16375644 missense probably damaging 1.00
R6802:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15996787 missense probably damaging 0.99
R6831:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6831:Fat3 UTSW 9 16376551 missense probably damaging 0.98
R6833:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15999268 missense probably benign
R6894:Fat3 UTSW 9 15997776 missense probably damaging 1.00
R6915:Fat3 UTSW 9 16377748 missense probably benign 0.37
R6931:Fat3 UTSW 9 15959942 missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16376956 missense probably damaging 0.98
R6940:Fat3 UTSW 9 15916800 intron probably null
R6959:Fat3 UTSW 9 15996885 missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16029916 missense probably benign 0.29
R6986:Fat3 UTSW 9 16021335 missense probably damaging 1.00
R6993:Fat3 UTSW 9 15919221 missense probably damaging 1.00
R7039:Fat3 UTSW 9 16376265 missense probably damaging 1.00
R7051:Fat3 UTSW 9 16377827 missense probably damaging 1.00
R7089:Fat3 UTSW 9 15996918 missense probably benign 0.01
R7136:Fat3 UTSW 9 16378185 missense probably benign
R7137:Fat3 UTSW 9 15997148 missense probably damaging 1.00
R7154:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R7170:Fat3 UTSW 9 16006574 missense probably damaging 0.99
R7183:Fat3 UTSW 9 15922837 missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16377214 missense probably damaging 1.00
R7288:Fat3 UTSW 9 15998592 missense probably damaging 1.00
R7293:Fat3 UTSW 9 15915040 missense
R7293:Fat3 UTSW 9 15915296 missense
R7381:Fat3 UTSW 9 16246987 missense probably damaging 1.00
X0021:Fat3 UTSW 9 16029931 missense probably null 0.66
X0026:Fat3 UTSW 9 15996333 missense probably benign
X0064:Fat3 UTSW 9 15919277 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCGTCTTCAATCCCAATGG -3'
(R):5'- GGACTGGGAAAGCTTCTCTTATG -3'

Sequencing Primer
(F):5'- AATCCCAATGGTGACTTGTGC -3'
(R):5'- GGGAAAGCTTCTCTTATGGCTATAAC -3'
Posted On2014-10-01