Incidental Mutation 'R2136:Vasn'
ID235845
Institutional Source Beutler Lab
Gene Symbol Vasn
Ensembl Gene ENSMUSG00000039646
Gene Namevasorin
SynonymsATIA, Slitl2, 2610528G05Rik
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4639941-4650802 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4649795 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 535 (C535*)
Ref Sequence ENSEMBL: ENSMUSP00000045162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000038770] [ENSMUST00000090480] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably null
Transcript: ENSMUST00000038770
AA Change: C535*
SMART Domains Protein: ENSMUSP00000045162
Gene: ENSMUSG00000039646
AA Change: C535*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
LRRNT 24 57 4.05e-5 SMART
LRR_TYP 76 99 8.15e-6 SMART
LRR_TYP 100 123 6.23e-2 SMART
LRR_TYP 124 147 6.42e-4 SMART
LRR 169 192 1.99e0 SMART
low complexity region 197 206 N/A INTRINSIC
LRR 216 238 6.22e0 SMART
LRR 239 263 1.16e2 SMART
LRR 264 287 1.15e1 SMART
LRRCT 299 351 2.03e-11 SMART
EGF 409 443 2.79e-4 SMART
FN3 460 544 2.72e-3 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144815
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to TNFalpha-induced lethality, TNFalpha-, cycloheximide-, or CoCl2-induced cell death, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Vasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vasn APN 16 4648368 missense probably benign 0.00
IGL01543:Vasn APN 16 4649892 missense possibly damaging 0.60
R1394:Vasn UTSW 16 4649712 nonsense probably null
R1459:Vasn UTSW 16 4648609 unclassified probably null
R4482:Vasn UTSW 16 4648326 missense possibly damaging 0.87
R5423:Vasn UTSW 16 4648420 missense probably benign 0.01
R5733:Vasn UTSW 16 4650162 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATGAAGCCCAGCTCCATAC -3'
(R):5'- AGCTGTAGAAGTTGCCCGTG -3'

Sequencing Primer
(F):5'- ACCTCCTTGCGTGTGAAG -3'
(R):5'- ACACAGTAGGCTGCCCCTG -3'
Posted On2014-10-01