Incidental Mutation 'R2137:Cdh7'
ID235856
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 040140-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110100106 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 527 (N527I)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably damaging
Transcript: ENSMUST00000027542
AA Change: N527I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: N527I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112701
AA Change: N527I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: N527I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect unknown
Transcript: ENSMUST00000134301
AA Change: N47I
SMART Domains Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312
AA Change: N47I

DomainStartEndE-ValueType
CA 24 111 2.26e-9 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172005
AA Change: N527I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: N527I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTGGTACACCTGATCTATTCCC -3'
(R):5'- TAAATAGCAGCTTCTCCTCTATGG -3'

Sequencing Primer
(F):5'- CCCTGGATTCATTCAAAAAGATGGC -3'
(R):5'- AGGAGCTAATGCTTGCA -3'
Posted On2014-10-01