Incidental Mutation 'R2137:Fgg'
ID235864
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Namefibrinogen gamma chain
Synonymsgamma-fibrinogen, 3010002H13Rik
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83007724-83015049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83008438 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 62 (D62V)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048486
AA Change: D62V

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: D62V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193581
Predicted Effect possibly damaging
Transcript: ENSMUST00000194175
AA Change: D62V

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: D62V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 83014228 missense possibly damaging 0.67
IGL01713:Fgg APN 3 83008416 missense probably benign 0.20
IGL02288:Fgg APN 3 83008153 missense probably benign 0.11
IGL02994:Fgg APN 3 83008474 missense probably benign
PIT4519001:Fgg UTSW 3 83012939 missense probably damaging 1.00
R1251:Fgg UTSW 3 83012980 missense probably benign 0.03
R2400:Fgg UTSW 3 83008187 missense possibly damaging 0.94
R2436:Fgg UTSW 3 83014189 missense possibly damaging 0.94
R3429:Fgg UTSW 3 83012783 missense probably damaging 1.00
R4356:Fgg UTSW 3 83012943 missense probably damaging 1.00
R4612:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4613:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4828:Fgg UTSW 3 83008370 splice site probably benign
R4898:Fgg UTSW 3 83008540 missense probably benign 0.02
R4938:Fgg UTSW 3 83012868 missense probably benign 0.00
R4967:Fgg UTSW 3 83012765 missense probably benign 0.33
R5635:Fgg UTSW 3 83011423 missense probably benign 0.07
R5740:Fgg UTSW 3 83011525 missense probably benign 0.01
R6307:Fgg UTSW 3 83012976 missense probably damaging 0.98
R6731:Fgg UTSW 3 83012901 missense probably damaging 1.00
R6936:Fgg UTSW 3 83008420 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGAAAACAGGGTAGCACTTTC -3'
(R):5'- AGACTTCTGAGTGGCACTGTC -3'

Sequencing Primer
(F):5'- CAGGGTAGCACTTTCATTTATCAG -3'
(R):5'- GGCACTGTCTATCATACCTGTAACAG -3'
Posted On2014-10-01