Incidental Mutation 'R2137:Kctd10'
ID235876
Institutional Source Beutler Lab
Gene Symbol Kctd10
Ensembl Gene ENSMUSG00000001098
Gene Namepotassium channel tetramerisation domain containing 10
Synonyms
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114363567-114380508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114367328 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 202 (F202L)
Ref Sequence ENSEMBL: ENSMUSP00000099641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001125] [ENSMUST00000102581] [ENSMUST00000124316] [ENSMUST00000134532] [ENSMUST00000169347] [ENSMUST00000196467] [ENSMUST00000196676] [ENSMUST00000199567] [ENSMUST00000202006]
Predicted Effect probably damaging
Transcript: ENSMUST00000001125
AA Change: F203L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001125
Gene: ENSMUSG00000001098
AA Change: F203L

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 3.21e-19 SMART
low complexity region 287 303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102581
AA Change: F202L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099641
Gene: ENSMUSG00000001098
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 6.89e-19 SMART
low complexity region 286 302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123538
Predicted Effect probably benign
Transcript: ENSMUST00000124316
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134173
Predicted Effect probably benign
Transcript: ENSMUST00000134532
SMART Domains Protein: ENSMUSP00000138564
Gene: ENSMUSG00000001098

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:BTB_2 34 89 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152694
Predicted Effect probably benign
Transcript: ENSMUST00000169347
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196467
SMART Domains Protein: ENSMUSP00000144133
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Blast:MYSc 1 52 7e-10 BLAST
Pfam:Myosin_TH1 70 181 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196676
SMART Domains Protein: ENSMUSP00000144682
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 204 7.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197773
Predicted Effect probably benign
Transcript: ENSMUST00000199567
SMART Domains Protein: ENSMUSP00000144492
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 213 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202006
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds proliferating cell nuclear antigen (PCNA) and may be involved in DNA synthesis and cell proliferation. In addition, the encoded protein may be a tumor suppressor. Several protein-coding and non-protein coding transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E10.5 and E11.5, abnormal vasculature, absent vitelline circulation, enlarged pericardium, thin myocardium and defective heart valve defect formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Kctd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kctd10 APN 5 114367349 missense probably damaging 1.00
IGL00832:Kctd10 APN 5 114368936 splice site probably null
R1666:Kctd10 UTSW 5 114368990 missense probably benign 0.01
R2223:Kctd10 UTSW 5 114367349 missense probably benign 0.26
R3037:Kctd10 UTSW 5 114375000 missense probably damaging 1.00
R3522:Kctd10 UTSW 5 114374923 missense probably damaging 1.00
R5390:Kctd10 UTSW 5 114365703 missense possibly damaging 0.56
R5794:Kctd10 UTSW 5 114367337 missense probably damaging 1.00
R5903:Kctd10 UTSW 5 114380462 unclassified probably benign
R6938:Kctd10 UTSW 5 114370130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGAATCCGGCCAGATTG -3'
(R):5'- CTCAGGGGCTCACTTTCAGTAG -3'

Sequencing Primer
(F):5'- GTAGGAAGTGCCCCCATTTC -3'
(R):5'- GGGCTCACTTTCAGTAGAGATAG -3'
Posted On2014-10-01