Incidental Mutation 'R2137:Ccdc129'
ID235879
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55889189 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 189 (Q189R)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect probably damaging
Transcript: ENSMUST00000044729
AA Change: Q189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: Q189R

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCATTCCTGAATGGCTGG -3'
(R):5'- GGGCAGATCAGTCTTGCTTC -3'

Sequencing Primer
(F):5'- TGGCTGGAATTTTGGGAAAAAGATCC -3'
(R):5'- ACATAGCAAACCATGGTAGATAATC -3'
Posted On2014-10-01