Incidental Mutation 'R2137:Lats1'
ID235896
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Namelarge tumor suppressor
Synonyms
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7681214-7716460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7701847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040043
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: V245A

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165952
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: V245A

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217931
AA Change: V245A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7691566 missense probably damaging 0.99
IGL00595:Lats1 APN 10 7702305 missense probably benign 0.00
IGL00932:Lats1 APN 10 7712742 missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7705671 missense probably damaging 1.00
IGL01380:Lats1 APN 10 7691780 missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7701706 missense probably benign 0.10
IGL02027:Lats1 APN 10 7712948 missense probably benign
IGL02611:Lats1 APN 10 7705787 missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7702254 missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7712746 missense probably benign 0.15
I1329:Lats1 UTSW 10 7712802 missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7705605 missense probably damaging 1.00
R0153:Lats1 UTSW 10 7691575 missense probably damaging 1.00
R0568:Lats1 UTSW 10 7712528 missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7702941 missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7712661 missense probably damaging 0.96
R1681:Lats1 UTSW 10 7705914 missense probably damaging 0.99
R1694:Lats1 UTSW 10 7701945 missense probably benign 0.07
R1840:Lats1 UTSW 10 7710939 nonsense probably null
R1914:Lats1 UTSW 10 7710457 splice site probably benign
R2317:Lats1 UTSW 10 7691776 nonsense probably null
R3863:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R3864:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R4597:Lats1 UTSW 10 7691746 missense probably benign 0.00
R4657:Lats1 UTSW 10 7705684 missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7702729 missense probably benign
R4663:Lats1 UTSW 10 7712583 missense probably damaging 1.00
R4870:Lats1 UTSW 10 7705785 missense probably damaging 1.00
R5101:Lats1 UTSW 10 7712584 nonsense probably null
R5134:Lats1 UTSW 10 7691811 missense probably benign 0.34
R5150:Lats1 UTSW 10 7712651 missense probably benign
R5546:Lats1 UTSW 10 7705754 missense probably damaging 0.99
R5820:Lats1 UTSW 10 7705908 missense probably damaging 1.00
R6006:Lats1 UTSW 10 7705595 missense probably damaging 1.00
R6301:Lats1 UTSW 10 7703107 missense probably benign 0.01
R6544:Lats1 UTSW 10 7701670 missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7697507 missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7710851 missense probably damaging 1.00
X0026:Lats1 UTSW 10 7710623 missense probably damaging 1.00
X0053:Lats1 UTSW 10 7691609 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTTCCTCAGAGACACGGC -3'
(R):5'- CAGAACTAATGGCCCTCTGAGC -3'

Sequencing Primer
(F):5'- CGGCCCATCTCTAGGAGAAAATG -3'
(R):5'- AGCCTGGCTAGGGGGATTC -3'
Posted On2014-10-01