Incidental Mutation 'R2137:Ankrd24'
ID235899
Institutional Source Beutler Lab
Gene Symbol Ankrd24
Ensembl Gene ENSMUSG00000054708
Gene Nameankyrin repeat domain 24
Synonyms4631433D01Rik, 5730519E19Rik, D10Bur2e
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81628540-81647610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81646309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 88 (T88I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119336] [ENSMUST00000123993] [ENSMUST00000189672]
Predicted Effect probably benign
Transcript: ENSMUST00000119336
AA Change: T897I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112932
Gene: ENSMUSG00000054708
AA Change: T897I

DomainStartEndE-ValueType
Blast:ANK 18 48 1e-6 BLAST
ANK 52 81 2.92e-2 SMART
ANK 85 114 7.53e-5 SMART
ANK 118 149 4.07e-1 SMART
ANK 151 180 2.92e-2 SMART
ANK 184 213 3.97e-4 SMART
low complexity region 240 250 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
internal_repeat_2 488 606 4.87e-8 PROSPERO
internal_repeat_2 597 713 4.87e-8 PROSPERO
low complexity region 718 736 N/A INTRINSIC
coiled coil region 747 895 N/A INTRINSIC
Blast:ANK 950 977 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123305
Predicted Effect probably benign
Transcript: ENSMUST00000123993
SMART Domains Protein: ENSMUSP00000117975
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ANK 48 78 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132458
AA Change: T88I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121709
Gene: ENSMUSG00000054708
AA Change: T88I

DomainStartEndE-ValueType
coiled coil region 1 94 N/A INTRINSIC
Blast:ANK 142 175 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154707
Predicted Effect probably benign
Transcript: ENSMUST00000189672
SMART Domains Protein: ENSMUSP00000140398
Gene: ENSMUSG00000096856

DomainStartEndE-ValueType
KRAB 4 66 1.5e-18 SMART
ZnF_C2H2 104 126 6.4e-6 SMART
ZnF_C2H2 132 154 4.4e-8 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 3.5e-6 SMART
ZnF_C2H2 216 238 2.9e-6 SMART
ZnF_C2H2 244 266 3e-5 SMART
ZnF_C2H2 272 294 7.7e-6 SMART
ZnF_C2H2 300 322 2e-5 SMART
ZnF_C2H2 328 350 1.4e-6 SMART
ZnF_C2H2 356 378 1.4e-4 SMART
ZnF_C2H2 384 406 9.4e-6 SMART
ZnF_C2H2 412 434 4.3e-5 SMART
ZnF_C2H2 440 462 2e-6 SMART
ZnF_C2H2 468 490 3.7e-4 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Ankrd24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Ankrd24 APN 10 81643145 unclassified probably benign
IGL00809:Ankrd24 APN 10 81643067 unclassified probably benign
IGL01021:Ankrd24 APN 10 81635161 splice site probably null
IGL01073:Ankrd24 APN 10 81639322 missense possibly damaging 0.76
IGL01875:Ankrd24 APN 10 81629737 unclassified probably benign
IGL03083:Ankrd24 APN 10 81638649 missense probably benign
IGL03335:Ankrd24 APN 10 81647133 missense probably benign 0.18
R0129:Ankrd24 UTSW 10 81638329 missense probably damaging 1.00
R0243:Ankrd24 UTSW 10 81634944 missense probably damaging 1.00
R0522:Ankrd24 UTSW 10 81636355 splice site probably benign
R0607:Ankrd24 UTSW 10 81638308 missense probably damaging 0.98
R0707:Ankrd24 UTSW 10 81642713 unclassified probably benign
R1472:Ankrd24 UTSW 10 81634920 missense probably damaging 1.00
R1766:Ankrd24 UTSW 10 81638638 missense probably benign 0.13
R1852:Ankrd24 UTSW 10 81642941 unclassified probably benign
R1891:Ankrd24 UTSW 10 81643508 unclassified probably benign
R3790:Ankrd24 UTSW 10 81642679 unclassified probably benign
R4798:Ankrd24 UTSW 10 81643315 unclassified probably benign
R4952:Ankrd24 UTSW 10 81647148 missense probably benign 0.01
R5068:Ankrd24 UTSW 10 81639865 missense possibly damaging 0.87
R5237:Ankrd24 UTSW 10 81642545 unclassified probably benign
R5418:Ankrd24 UTSW 10 81644942 unclassified probably benign
R5795:Ankrd24 UTSW 10 81645103 unclassified probably benign
R7188:Ankrd24 UTSW 10 81636390 nonsense probably null
Z1088:Ankrd24 UTSW 10 81638656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTGTTCTGGCAAGCAC -3'
(R):5'- ATGTCCAGTGGCTGCTAGTG -3'

Sequencing Primer
(F):5'- TGGCAAGCACCAGTGTG -3'
(R):5'- TAGTGACTGCCTCGGGAAG -3'
Posted On2014-10-01