Incidental Mutation 'R2137:Slc47a1'
ID235901
Institutional Source Beutler Lab
Gene Symbol Slc47a1
Ensembl Gene ENSMUSG00000010122
Gene Namesolute carrier family 47, member 1
SynonymsmMATE1, 1300013J15Rik, MATE1
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61343401-61378345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61344492 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 505 (D505V)
Ref Sequence ENSEMBL: ENSMUSP00000010267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000093029] [ENSMUST00000131723] [ENSMUST00000134423]
Predicted Effect probably benign
Transcript: ENSMUST00000010267
AA Change: D505V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: D505V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093029
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131723
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134423
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147450
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased blood urea nitrogen, increased circulating creatinine, and abnormal metformin pahrmacokinetics including increased plasma and tissue concentration with decreased kidney and liver clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Slc47a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Slc47a1 APN 11 61370124 missense probably damaging 1.00
IGL02399:Slc47a1 APN 11 61363058 missense probably damaging 1.00
IGL02586:Slc47a1 APN 11 61344321 missense probably benign 0.14
IGL02832:Slc47a1 APN 11 61363413 missense probably benign 0.01
IGL02873:Slc47a1 APN 11 61362817 unclassified probably benign
IGL03038:Slc47a1 APN 11 61353092 missense probably benign 0.14
R0392:Slc47a1 UTSW 11 61371782 missense probably damaging 1.00
R0927:Slc47a1 UTSW 11 61373422 missense probably damaging 0.96
R1255:Slc47a1 UTSW 11 61370148 missense probably damaging 1.00
R1507:Slc47a1 UTSW 11 61359518 critical splice donor site probably null
R1625:Slc47a1 UTSW 11 61371799 missense probably damaging 1.00
R2029:Slc47a1 UTSW 11 61378007 intron probably benign
R2434:Slc47a1 UTSW 11 61367722 splice site probably null
R3115:Slc47a1 UTSW 11 61367680 missense possibly damaging 0.88
R3752:Slc47a1 UTSW 11 61344381 missense possibly damaging 0.84
R3839:Slc47a1 UTSW 11 61353058 splice site probably benign
R4499:Slc47a1 UTSW 11 61359529 missense probably benign
R4516:Slc47a1 UTSW 11 61344513 missense probably benign
R4675:Slc47a1 UTSW 11 61363031 missense probably benign 0.41
R4727:Slc47a1 UTSW 11 61363451 missense possibly damaging 0.48
R4839:Slc47a1 UTSW 11 61373350 splice site probably null
R4869:Slc47a1 UTSW 11 61362694 missense probably benign 0.02
R5164:Slc47a1 UTSW 11 61353060 splice site probably null
R5633:Slc47a1 UTSW 11 61369261 missense probably damaging 1.00
R5957:Slc47a1 UTSW 11 61344342 missense probably benign 0.06
R6793:Slc47a1 UTSW 11 61359403 missense probably benign
R6952:Slc47a1 UTSW 11 61344454 missense probably benign 0.04
R7082:Slc47a1 UTSW 11 61377941 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTGGATTGATGGCATTCCC -3'
(R):5'- CGCCCTAAGATGCTTGCTTG -3'

Sequencing Primer
(F):5'- GGCATTCCCACATTATTCAATTCTG -3'
(R):5'- CTAAGATGCTTGCTTGCTTGC -3'
Posted On2014-10-01