Incidental Mutation 'R2137:Nampt'
ID235905
Institutional Source Beutler Lab
Gene Symbol Nampt
Ensembl Gene ENSMUSG00000020572
Gene Namenicotinamide phosphoribosyltransferase
SynonymsPbef1, 1110035O14Rik, Visfatin
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location32819545-32853349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32830310 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 67 (N67K)
Ref Sequence ENSEMBL: ENSMUSP00000020886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020886] [ENSMUST00000220200]
PDB Structure
Crystal Structure of Murine NMPRTase [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor 1 [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor in Complex with Nicotinamide Mononuleotide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020886
AA Change: N67K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020886
Gene: ENSMUSG00000020572
AA Change: N67K

DomainStartEndE-ValueType
Pfam:NAPRTase 188 466 1.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218491
Predicted Effect probably benign
Transcript: ENSMUST00000220200
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to E10.5. Mice heterozygous for a null allele exhibit increased fasted glucose in male mice and impaired glucose tolerance and decresed glucose-stimulated insulin secretion in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Nampt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Nampt APN 12 32830216 missense probably damaging 1.00
IGL02512:Nampt APN 12 32830269 missense possibly damaging 0.72
IGL03095:Nampt APN 12 32842686 missense possibly damaging 0.85
Nacht UTSW 12 32833038 missense probably damaging 1.00
R0020:Nampt UTSW 12 32841013 missense probably damaging 0.97
R0417:Nampt UTSW 12 32833101 missense probably benign 0.01
R1087:Nampt UTSW 12 32833043 missense possibly damaging 0.88
R1781:Nampt UTSW 12 32833038 missense probably damaging 1.00
R2138:Nampt UTSW 12 32838422 missense possibly damaging 0.46
R3699:Nampt UTSW 12 32848759 splice site probably benign
R3970:Nampt UTSW 12 32833096 missense probably benign 0.02
R4434:Nampt UTSW 12 32838363 missense probably damaging 1.00
R4785:Nampt UTSW 12 32848714 missense possibly damaging 0.95
R5046:Nampt UTSW 12 32833038 missense probably damaging 1.00
R5055:Nampt UTSW 12 32833121 missense possibly damaging 0.94
R5427:Nampt UTSW 12 32834915 missense probably benign 0.00
R6063:Nampt UTSW 12 32848659 missense probably damaging 1.00
R6136:Nampt UTSW 12 32830302 missense probably benign 0.24
R6995:Nampt UTSW 12 32848743 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACTGTACTGGTAGTGTTTCCTAATG -3'
(R):5'- TCACCAAATTTAAGGCCAGGC -3'

Sequencing Primer
(F):5'- TTCCTACTTTGAATGCCG -3'
(R):5'- CTAGGCTACAGAGTAAGGTGTTG -3'
Posted On2014-10-01