Incidental Mutation 'R2137:Olfr1475'
ID235920
Institutional Source Beutler Lab
Gene Symbol Olfr1475
Ensembl Gene ENSMUSG00000096708
Gene Nameolfactory receptor 1475
SynonymsGA_x6K02T2RE5P-3812807-3811863, MOR202-36
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13479252-13480196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13479809 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 130 (Y130H)
Ref Sequence ENSEMBL: ENSMUSP00000079616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080801]
Predicted Effect probably damaging
Transcript: ENSMUST00000080801
AA Change: Y130H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079616
Gene: ENSMUSG00000096708
AA Change: Y130H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.7e-9 PFAM
Pfam:7tm_1 39 288 1.6e-20 PFAM
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1480 T A 19: 13,530,438 I255N probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Olfr1475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr1475 APN 19 13479787 missense possibly damaging 0.81
IGL01604:Olfr1475 APN 19 13479248 unclassified probably benign
IGL01656:Olfr1475 APN 19 13480090 missense probably benign 0.08
IGL01802:Olfr1475 APN 19 13479365 missense probably benign 0.05
IGL01839:Olfr1475 APN 19 13479440 missense probably benign
IGL02255:Olfr1475 APN 19 13479985 missense probably damaging 1.00
IGL02706:Olfr1475 APN 19 13480098 nonsense probably null
IGL02723:Olfr1475 APN 19 13479335 missense probably damaging 1.00
IGL03143:Olfr1475 APN 19 13479471 missense probably damaging 1.00
IGL03174:Olfr1475 APN 19 13480069 missense probably benign 0.10
R0442:Olfr1475 UTSW 19 13480048 missense probably damaging 1.00
R0490:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R0491:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R1757:Olfr1475 UTSW 19 13479607 missense possibly damaging 0.67
R1843:Olfr1475 UTSW 19 13479931 missense probably benign 0.00
R1972:Olfr1475 UTSW 19 13479694 missense probably benign 0.00
R3150:Olfr1475 UTSW 19 13479460 missense probably damaging 1.00
R3858:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3859:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3953:Olfr1475 UTSW 19 13479442 missense probably benign 0.43
R4611:Olfr1475 UTSW 19 13480012 missense probably damaging 0.96
R4934:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R5580:Olfr1475 UTSW 19 13479427 missense probably damaging 1.00
R6278:Olfr1475 UTSW 19 13479755 missense probably benign
R6444:Olfr1475 UTSW 19 13479430 missense possibly damaging 0.95
R6796:Olfr1475 UTSW 19 13479914 missense probably damaging 1.00
R6812:Olfr1475 UTSW 19 13479611 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAGAGATGTCCAGCAGTG -3'
(R):5'- GATTCTGCTAGATTCCCGACTC -3'

Sequencing Primer
(F):5'- TCCAGCAGTGGGGGAATGTC -3'
(R):5'- GTAACCTCTCCCTGGTGGACTG -3'
Posted On2014-10-01