Incidental Mutation 'R2137:Olfr1480'
ID235921
Institutional Source Beutler Lab
Gene Symbol Olfr1480
Ensembl Gene ENSMUSG00000095484
Gene Nameolfactory receptor 1480
SynonymsMOR202-44, GA_x6K02T2RE5P-3862389-3863336
MMRRC Submission 040140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2137 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13527913-13531275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13530438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 255 (I255N)
Ref Sequence ENSEMBL: ENSMUSP00000147226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072219] [ENSMUST00000207093] [ENSMUST00000207904] [ENSMUST00000207987]
Predicted Effect probably damaging
Transcript: ENSMUST00000072219
AA Change: I255N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072076
Gene: ENSMUSG00000095484
AA Change: I255N

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 8.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.6e-6 PFAM
Pfam:7tm_1 40 289 4.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207093
AA Change: I255N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207312
Predicted Effect probably damaging
Transcript: ENSMUST00000207904
AA Change: I255N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000207987
AA Change: I299N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216709
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd24 C T 10: 81,646,309 T88I probably damaging Het
Atm A T 9: 53,453,375 V49D probably damaging Het
Bub1b G T 2: 118,636,718 E841* probably null Het
Ccdc129 A G 6: 55,889,189 Q189R probably damaging Het
Cdh22 G A 2: 165,116,394 probably benign Het
Cdh7 A T 1: 110,100,106 N527I probably damaging Het
Cog1 T C 11: 113,659,301 L262P probably damaging Het
Col22a1 T C 15: 72,006,948 H120R possibly damaging Het
Col4a2 T C 8: 11,433,749 S890P probably benign Het
Cubn T C 2: 13,336,167 I2248V probably benign Het
Evpl T C 11: 116,221,839 E1675G probably damaging Het
Faiml G A 9: 99,232,492 P115S probably benign Het
Fgg A T 3: 83,008,438 D62V possibly damaging Het
Gak C T 5: 108,606,877 probably null Het
Galntl6 C T 8: 58,535,905 probably null Het
Glyr1 T C 16: 5,018,482 Y501C probably benign Het
Gm9847 G T 12: 14,495,081 noncoding transcript Het
Gria4 T G 9: 4,427,026 probably benign Het
Il1f8 A G 2: 24,154,660 N24S probably benign Het
Il6st C A 13: 112,502,858 H606N possibly damaging Het
Kctd10 A G 5: 114,367,328 F202L probably damaging Het
Kif17 T A 4: 138,262,667 D55E probably damaging Het
Klf1 C T 8: 84,903,146 A200V possibly damaging Het
Klhl32 A T 4: 24,629,275 Y497* probably null Het
Kng2 G T 16: 22,997,326 probably benign Het
Lats1 T C 10: 7,701,847 V245A possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Mss51 T C 14: 20,487,523 I47V probably benign Het
Myoz2 G A 3: 123,034,212 T19M probably benign Het
Nampt T A 12: 32,830,310 N67K probably benign Het
Ncor2 A T 5: 125,030,712 I1607K probably damaging Het
Nudt4 T C 10: 95,563,738 Q7R probably damaging Het
Olfr1475 A G 19: 13,479,809 Y130H probably damaging Het
Olfr870 T A 9: 20,171,167 I135F probably damaging Het
Pgm1 A T 5: 64,116,366 M565L probably benign Het
Phactr1 T G 13: 43,135,175 F639V possibly damaging Het
Plod3 C A 5: 136,988,717 R165S probably damaging Het
Polr2b T A 5: 77,320,346 N164K probably benign Het
Rcbtb2 G A 14: 73,162,051 G52S probably damaging Het
Rfc1 A G 5: 65,311,039 probably null Het
Rheb A G 5: 24,807,603 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor2 G A 13: 24,721,834 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scg3 A T 9: 75,676,810 D136E probably damaging Het
Slc10a4 C T 5: 73,007,580 L172F probably damaging Het
Slc35c2 A G 2: 165,281,379 Y113H probably damaging Het
Slc47a1 T A 11: 61,344,492 D505V probably benign Het
Snap29 C A 16: 17,428,249 D244E possibly damaging Het
Taar1 T C 10: 23,921,270 F289L probably benign Het
Thbs2 T A 17: 14,673,306 N871Y probably damaging Het
Tmem108 T A 9: 103,499,963 T96S possibly damaging Het
Tnk2 G T 16: 32,670,802 probably null Het
Trak1 T A 9: 121,472,962 M928K possibly damaging Het
Tuba3b A G 6: 145,618,833 I110V probably benign Het
Tyk2 A G 9: 21,110,985 probably benign Het
Ugt1a9 T A 1: 88,071,037 C70S probably benign Het
Vmn2r10 A T 5: 109,003,544 I68K possibly damaging Het
Wfs1 T C 5: 36,967,501 E682G probably damaging Het
Zfp213 T C 17: 23,559,507 probably null Het
Zfp809 T C 9: 22,235,138 V41A probably benign Het
Zfp831 A G 2: 174,705,746 K1574R possibly damaging Het
Other mutations in Olfr1480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1480 APN 19 13529850 missense probably damaging 1.00
IGL01446:Olfr1480 APN 19 13530252 missense probably benign 0.00
IGL02300:Olfr1480 APN 19 13529880 missense probably damaging 1.00
IGL02689:Olfr1480 APN 19 13529807 missense probably benign 0.34
IGL03119:Olfr1480 APN 19 13530435 missense probably benign 0.11
R0636:Olfr1480 UTSW 19 13530249 missense possibly damaging 0.89
R1665:Olfr1480 UTSW 19 13529838 missense probably damaging 1.00
R1708:Olfr1480 UTSW 19 13529913 missense probably damaging 1.00
R2100:Olfr1480 UTSW 19 13530434 missense probably benign 0.02
R3879:Olfr1480 UTSW 19 13530249 missense probably damaging 1.00
R3949:Olfr1480 UTSW 19 13530020 missense probably damaging 0.99
R4780:Olfr1480 UTSW 19 13529955 missense probably benign 0.30
R4953:Olfr1480 UTSW 19 13529814 missense probably null 1.00
R5075:Olfr1480 UTSW 19 13530273 missense probably benign 0.17
R5133:Olfr1480 UTSW 19 13530078 missense probably damaging 1.00
R5656:Olfr1480 UTSW 19 13530380 missense probably benign
R6853:Olfr1480 UTSW 19 13529931 missense possibly damaging 0.48
R6890:Olfr1480 UTSW 19 13530081 missense probably damaging 1.00
Z1088:Olfr1480 UTSW 19 13529852 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTCTTTATGTTGGCAGCATTCAATG -3'
(R):5'- GTCTGAATCCAAAAGGAATACACAG -3'

Sequencing Primer
(F):5'- CAGCATTCAATGTTGCTTTTACTC -3'
(R):5'- AATTGACTAATCCCAGTGAAAGC -3'
Posted On2014-10-01