Incidental Mutation 'R2138:Gatad2b'
ID235935
Institutional Source Beutler Lab
Gene Symbol Gatad2b
Ensembl Gene ENSMUSG00000042390
Gene NameGATA zinc finger domain containing 2B
Synonymsp66beta, C430014D17Rik
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90293178-90363407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90352113 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 401 (S401R)
Ref Sequence ENSEMBL: ENSMUSP00000142514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049382] [ENSMUST00000197988] [ENSMUST00000199607] [ENSMUST00000199754]
Predicted Effect probably damaging
Transcript: ENSMUST00000049382
AA Change: S401R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041370
Gene: ENSMUSG00000042390
AA Change: S401R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Pfam:P66_CC 158 201 1.7e-21 PFAM
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 1e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196212
Predicted Effect probably damaging
Transcript: ENSMUST00000197988
AA Change: S385R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143085
Gene: ENSMUSG00000042390
AA Change: S385R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 325 345 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
Pfam:GATA 405 439 9.3e-11 PFAM
coiled coil region 440 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199607
AA Change: S401R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142617
Gene: ENSMUSG00000042390
AA Change: S401R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199754
AA Change: S401R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142514
Gene: ENSMUSG00000042390
AA Change: S401R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
coiled coil region 158 194 N/A INTRINSIC
low complexity region 341 361 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
Pfam:GATA 421 455 7.8e-11 PFAM
coiled coil region 456 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200373
Predicted Effect unknown
Transcript: ENSMUST00000206907
AA Change: S151R
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein transcriptional repressor. The encoded protein is part of the methyl-CpG-binding protein-1 complex, which represses gene expression by deacetylating methylated nucleosomes. Mutations in this gene are linked to intellectual disability and dysmorphic features associated with mental retardation. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Gatad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Gatad2b APN 3 90352078 missense possibly damaging 0.93
IGL02172:Gatad2b APN 3 90355671 splice site probably benign
IGL02672:Gatad2b APN 3 90341891 missense possibly damaging 0.77
IGL03030:Gatad2b APN 3 90341937 missense probably benign 0.11
FR4449:Gatad2b UTSW 3 90341917 small deletion probably benign
R0083:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0108:Gatad2b UTSW 3 90357943 missense probably damaging 1.00
R0335:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R0707:Gatad2b UTSW 3 90356182 missense probably benign 0.00
R1722:Gatad2b UTSW 3 90355679 missense probably damaging 1.00
R1782:Gatad2b UTSW 3 90341871 missense probably benign 0.01
R5954:Gatad2b UTSW 3 90351441 missense probably damaging 1.00
R6834:Gatad2b UTSW 3 90348643 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGTGACGCTGCCAACTC -3'
(R):5'- GGTACCCTTGAACTTGTAATCTTC -3'

Sequencing Primer
(F):5'- TGACGCTGCCAACTCACAGG -3'
(R):5'- GCCTTGAACTTGGAGCAATC -3'
Posted On2014-10-01