Incidental Mutation 'R2138:Mgam'
ID235951
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40756450 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 839 (P839S)
Ref Sequence ENSEMBL: ENSMUSP00000144627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: P1466S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: P1466S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: P1466S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: P1466S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202775
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: P839S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: P839S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202966
AA Change: P720S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: P720S

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Grm7 C A 6: 110,646,137 N90K probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2224:Mgam UTSW 6 40764274 unclassified probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 intron probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATGAGAAGATTCAGAACTGCC -3'
(R):5'- TCTGTCTCCATGCAGAAGTACTC -3'

Sequencing Primer
(F):5'- GAAGATTCAGAACTGCCTTTCATTC -3'
(R):5'- TTGAAGGACCCTTTCACAGG -3'
Posted On2014-10-01