Incidental Mutation 'R2138:Grm7'
ID235955
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission 040141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2138 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110646137 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 90 (N90K)
Ref Sequence ENSEMBL: ENSMUSP00000134635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably damaging
Transcript: ENSMUST00000071076
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: N90K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172951
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: N90K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173609
Predicted Effect probably damaging
Transcript: ENSMUST00000174018
AA Change: N90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: N90K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,283,963 V6A probably benign Het
Abcc6 A G 7: 45,981,051 F1262L probably damaging Het
Acot13 A T 13: 24,818,205 probably null Het
Adgrv1 T C 13: 81,445,320 I4183V probably benign Het
Aff4 T G 11: 53,372,512 S120A possibly damaging Het
Afp A G 5: 90,499,647 E250G probably damaging Het
Ankrd34b A T 13: 92,439,406 D382V probably damaging Het
Arhgef19 A T 4: 141,250,800 I577F probably damaging Het
Arl6 A G 16: 59,622,467 probably benign Het
Atp2b2 A T 6: 113,796,307 M333K probably benign Het
Atp8b3 C A 10: 80,527,105 A635S possibly damaging Het
Baiap2 A G 11: 119,957,102 T19A possibly damaging Het
Bcar3 A G 3: 122,512,996 D206G probably damaging Het
Ccdc162 A T 10: 41,581,297 M85K probably benign Het
Clec4a4 A G 6: 123,023,978 N217D probably damaging Het
Csmd1 T C 8: 15,929,088 Y2832C probably damaging Het
Cubn A G 2: 13,444,378 I962T probably damaging Het
Dennd4a A G 9: 64,889,337 Y852C probably damaging Het
Dhcr24 G T 4: 106,572,302 E191* probably null Het
Dusp12 G A 1: 170,880,597 Q114* probably null Het
Elfn2 G T 15: 78,674,038 T103K probably benign Het
Eme1 A T 11: 94,648,192 V314E probably damaging Het
Epb41l3 A G 17: 69,207,880 E4G probably damaging Het
Exoc6b A T 6: 84,989,482 L170Q probably damaging Het
Fam129a G A 1: 151,696,251 V316M probably damaging Het
Fbln5 C T 12: 101,761,920 M261I probably benign Het
Fgf22 T C 10: 79,756,601 V64A probably damaging Het
Gak C T 5: 108,606,877 probably null Het
Gatad2b T A 3: 90,352,113 S401R probably damaging Het
Gen1 A T 12: 11,241,621 S722R probably damaging Het
Gm10754 A T 10: 97,682,270 probably benign Het
Gm8897 A T 5: 11,419,085 R68* probably null Het
Grid2 G A 6: 64,345,798 R594Q probably damaging Het
Herc1 G A 9: 66,470,307 V3452M possibly damaging Het
Il22ra2 T A 10: 19,632,870 F215L probably benign Het
Kank1 G A 19: 25,411,753 G930D probably benign Het
Klra3 A T 6: 130,333,158 V133D probably benign Het
Lims2 A G 18: 31,955,407 E220G possibly damaging Het
Mbd3l2 A T 9: 18,444,958 D193V probably damaging Het
Mbl1 T A 14: 41,153,691 I34K possibly damaging Het
Mgam C T 6: 40,756,450 P839S probably damaging Het
Mmp9 G T 2: 164,952,467 E460* probably null Het
Mov10 T C 3: 104,804,242 H316R probably benign Het
Ms4a18 A T 19: 10,997,331 V332D possibly damaging Het
Myo15b T C 11: 115,883,807 S2082P probably benign Het
Myrfl G A 10: 116,795,538 T706I probably benign Het
Nampt C A 12: 32,838,422 H191N possibly damaging Het
Nphp3 A G 9: 104,025,903 E693G possibly damaging Het
Obscn A T 11: 59,003,665 Y1191* probably null Het
Olfr19 A G 16: 16,673,205 Y259H probably damaging Het
Olfr398 A T 11: 73,984,303 Y102N probably damaging Het
Olfr419 A T 1: 174,250,736 probably null Het
Osbpl10 A G 9: 115,232,134 N760S probably benign Het
Otof A G 5: 30,461,770 V10A probably benign Het
Pkhd1l1 A C 15: 44,501,457 E664A probably damaging Het
Pnp2 T C 14: 50,963,704 S178P probably damaging Het
Pvr G A 7: 19,917,002 T199I probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnaseh2b T C 14: 62,361,345 V173A probably benign Het
Sept12 C T 16: 4,992,206 R155H probably damaging Het
Slco6d1 G T 1: 98,443,660 R290L probably benign Het
Snx32 A G 19: 5,496,129 V335A probably damaging Het
Son T C 16: 91,659,372 V1669A possibly damaging Het
Tbata C T 10: 61,179,284 T116I probably benign Het
Tdrd1 T A 19: 56,842,589 S279T probably benign Het
Thsd7a A T 6: 12,471,073 Y515* probably null Het
Tmem102 T G 11: 69,805,114 L40F probably damaging Het
Tmem169 A G 1: 72,300,996 N195S probably damaging Het
Tmem201 A T 4: 149,718,080 S613T probably damaging Het
Tnfaip6 A T 2: 52,052,332 I218F possibly damaging Het
Tube1 C A 10: 39,147,351 H331Q probably benign Het
Wwc1 G A 11: 35,841,887 T998I possibly damaging Het
Xpc A T 6: 91,498,122 Y638* probably null Het
Zdhhc4 A T 5: 143,324,262 Y80* probably null Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
shaky UTSW 6 111495791 nonsense probably null
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGAAGTTCCCCTGCTG -3'
(R):5'- TCTCTGGCTTGACGAAAACCG -3'

Sequencing Primer
(F):5'- AGGTGCTCCTGTGCGTGC -3'
(R):5'- CTTGACGAAAACCGGGGGC -3'
Posted On2014-10-01