Incidental Mutation 'R2140:Mcm3'
ID236090
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Nameminichromosome maintenance complex component 3
SynonymsP1, p1.m, Mcmd
MMRRC Submission 040143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2140 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20802968-20820312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20813110 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
Predicted Effect probably benign
Transcript: ENSMUST00000053266
AA Change: V295A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: V295A

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185296
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20804815 critical splice donor site probably null
IGL01061:Mcm3 APN 1 20814496 missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20813056 missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20814680 splice site probably benign
IGL02483:Mcm3 APN 1 20803572 missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20808839 missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20810105 missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20805332 missense probably benign
R0467:Mcm3 UTSW 1 20804847 missense probably benign
R0669:Mcm3 UTSW 1 20804929 intron probably null
R1251:Mcm3 UTSW 1 20812672 nonsense probably null
R1599:Mcm3 UTSW 1 20820198 missense probably benign 0.08
R1764:Mcm3 UTSW 1 20805879 missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20803580 missense probably damaging 0.98
R3033:Mcm3 UTSW 1 20808768 missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20811993 nonsense probably null
R4513:Mcm3 UTSW 1 20810232 missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20809645 missense probably benign
R4713:Mcm3 UTSW 1 20803577 missense probably benign
R4801:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20820256 utr 5 prime probably benign
R5035:Mcm3 UTSW 1 20803418 utr 3 prime probably benign
R5461:Mcm3 UTSW 1 20814437 missense probably benign 0.00
R5486:Mcm3 UTSW 1 20814894 missense probably damaging 1.00
R5531:Mcm3 UTSW 1 20803544 missense possibly damaging 0.46
R5759:Mcm3 UTSW 1 20808748 frame shift probably null
R5760:Mcm3 UTSW 1 20808748 frame shift probably null
R6505:Mcm3 UTSW 1 20803544 missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R7179:Mcm3 UTSW 1 20814857 missense probably damaging 0.98
X0062:Mcm3 UTSW 1 20820137 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTAGTCTTCTGTACGTTGATGAGCC -3'
(R):5'- GTTTTGTGCCGTACGCTAC -3'

Sequencing Primer
(F):5'- GTACGTTGATGAGCCTAGAATATGAC -3'
(R):5'- GTGCCGTACGCTACCTCTTTAC -3'
Posted On2014-10-01