Incidental Mutation 'R2140:Mki67'
ID236137
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 040143-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R2140 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135695592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2571 (I2571T)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033310
AA Change: I2571T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: I2571T

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik T C 14: 4,348,902 I21T probably damaging Het
9230110C19Rik T C 9: 8,022,477 D248G probably damaging Het
Adgrf1 A C 17: 43,300,802 E186D probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agfg2 T A 5: 137,667,116 R126W probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Alppl2 A G 1: 87,087,697 S381P probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Atp9b A G 18: 80,736,087 C1123R probably damaging Het
AU016765 T A 17: 64,520,000 noncoding transcript Het
Bscl2 T C 19: 8,845,320 probably null Het
Ccdc80 A T 16: 45,127,446 Y929F probably damaging Het
Cenpj T C 14: 56,526,932 D1341G probably damaging Het
Cir1 A T 2: 73,312,437 S18T probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Crb1 T C 1: 139,237,012 I1125V probably benign Het
Cyp3a13 A T 5: 137,921,454 V20D possibly damaging Het
Dars T A 1: 128,372,162 M362L probably benign Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Dnah11 T C 12: 118,008,810 T2880A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Eef1a2 C T 2: 181,148,742 E374K probably benign Het
Eif3a A T 19: 60,775,394 probably benign Het
Esco1 A G 18: 10,574,873 probably null Het
Exoc8 C T 8: 124,897,415 R71Q possibly damaging Het
Fam208a C T 14: 27,480,035 T1462I probably damaging Het
Far1 G A 7: 113,566,460 V445M possibly damaging Het
Fbn1 C A 2: 125,343,810 C1648F probably damaging Het
Fmn1 A G 2: 113,595,048 K1189R probably benign Het
Foxl2 C A 9: 98,956,487 P276H unknown Het
Fpr3 T A 17: 17,970,617 V50E probably damaging Het
Garem1 T A 18: 21,129,374 R794S probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm14124 A T 2: 150,269,361 H657L probably benign Het
Gm4787 A G 12: 81,378,562 I274T probably benign Het
Gucy1a1 C T 3: 82,118,886 probably null Het
Hook1 GATGAATGA GATGA 4: 96,013,312 probably null Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ints13 A G 6: 146,576,431 S7P probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kcnma1 A C 14: 23,314,220 L988R probably damaging Het
Kcnq3 C A 15: 66,005,978 probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Lama2 A T 10: 27,054,694 probably null Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Lrrc58 G A 16: 37,881,409 E350K probably damaging Het
Lrrk1 A T 7: 66,330,750 D227E probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Madd A G 2: 91,152,509 I1363T possibly damaging Het
Mcm3 A G 1: 20,813,110 V295A probably benign Het
Mtrr C T 13: 68,568,940 A385T possibly damaging Het
Myh7b A G 2: 155,620,123 Y313C probably damaging Het
Myot A T 18: 44,354,125 H343L possibly damaging Het
Myt1 C A 2: 181,825,979 Q1069K probably damaging Het
Nid1 T A 13: 13,499,668 D877E probably damaging Het
Nle1 A G 11: 82,905,568 V159A probably damaging Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Nostrin A C 2: 69,166,003 Y209S probably damaging Het
Olfr1099 A T 2: 86,959,281 M59K probably damaging Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1168 A T 2: 88,185,095 S73C probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr378 A T 11: 73,425,881 M34K probably damaging Het
Pcdh7 T A 5: 58,128,996 V1138E probably damaging Het
Pglyrp3 T G 3: 92,026,567 V173G probably benign Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plxnb2 T C 15: 89,156,562 D1787G probably benign Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ptprt G A 2: 161,811,988 T574I probably damaging Het
R3hdm1 A G 1: 128,190,693 Y561C probably damaging Het
Rab17 A G 1: 90,960,078 F120S probably benign Het
Rab7b T A 1: 131,698,419 W62R probably damaging Het
Ryr2 C T 13: 11,560,607 G4835E probably damaging Het
Ryr3 A G 2: 112,875,148 V807A probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Slc23a1 C T 18: 35,626,434 R26Q unknown Het
Slc7a4 C A 16: 17,574,544 R342L possibly damaging Het
Slfn9 C T 11: 82,984,655 C367Y possibly damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tiam1 A G 16: 89,849,645 probably benign Het
Tiparp C A 3: 65,529,252 probably benign Het
Tmem39b T C 4: 129,678,688 T374A probably benign Het
Trim5 G A 7: 104,276,791 R188* probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Vmn2r26 A T 6: 124,061,237 E590D probably benign Het
Wwc1 A G 11: 35,870,528 F650S probably benign Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAAACTGGTGAGTTCTTCTAAGG -3'
(R):5'- GAAGTCAATGTGCCTCGCAG -3'

Sequencing Primer
(F):5'- CTAAGGGTTGGGTTTTCTCCTTAAC -3'
(R):5'- TCAATGTGCCTCGCAGTAAGAG -3'
Posted On2014-10-01