Incidental Mutation 'R2141:Kif18a'
ID236226
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109333503 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 732 (N732K)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect probably benign
Transcript: ENSMUST00000028527
AA Change: N732K

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: N732K

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3882:Kif18a UTSW 2 109306974 missense probably benign 0.01
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R4819:Kif18a UTSW 2 109292126 missense probably damaging 1.00
R5078:Kif18a UTSW 2 109295142 splice site probably benign
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R6886:Kif18a UTSW 2 109296663 missense probably damaging 1.00
R7069:Kif18a UTSW 2 109295002 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGCTTAAACTTACTCCACAACG -3'
(R):5'- GCTTTTGTACCTGTGCACACTG -3'

Sequencing Primer
(F):5'- AATTCCTTCTCCCTTGAAAGTACAAC -3'
(R):5'- GTACCTGTGCACACTGCTTTTG -3'
Posted On2014-10-01