Incidental Mutation 'R2141:Clcn6'
ID236235
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Namechloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148004259-148038821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148024137 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 145 (F145S)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030879
AA Change: F142S

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: F142S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105711
AA Change: F145S

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: F145S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131232
SMART Domains Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134377
Predicted Effect possibly damaging
Transcript: ENSMUST00000137724
AA Change: F145S

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: F145S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Tonsl A T 15: 76,632,661 I923N probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148017902 critical splice donor site probably null
IGL00434:Clcn6 APN 4 148013738 missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148013788 splice site probably benign
IGL01384:Clcn6 APN 4 148018966 missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148021451 splice site probably benign
IGL01522:Clcn6 APN 4 148017535 missense probably benign 0.44
R0194:Clcn6 UTSW 4 148012756 missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148008715 missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148024194 missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148014606 missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148038749 unclassified probably benign
R0927:Clcn6 UTSW 4 148029392 missense probably benign 0.30
R1141:Clcn6 UTSW 4 148013899 missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148024156 missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148012778 missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148012769 missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148014594 missense probably benign
R1596:Clcn6 UTSW 4 148023379 missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148017568 missense probably benign 0.00
R1769:Clcn6 UTSW 4 148014301 intron probably null
R2021:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2022:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2049:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148011068 missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148014600 missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148017494 critical splice donor site probably null
R2891:Clcn6 UTSW 4 148012616 critical splice donor site probably null
R3750:Clcn6 UTSW 4 148024187 nonsense probably null
R4014:Clcn6 UTSW 4 148017610 missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148024167 missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148019766 missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148008770 missense probably benign 0.05
R5140:Clcn6 UTSW 4 148038317 unclassified probably benign
R5345:Clcn6 UTSW 4 148038749 unclassified probably benign
R5467:Clcn6 UTSW 4 148017636 missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148014561 missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148014189 missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148017592 missense probably benign 0.01
R6043:Clcn6 UTSW 4 148008788 missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148017500 missense probably benign 0.01
R6593:Clcn6 UTSW 4 148010769 missense probably benign 0.21
R7440:Clcn6 UTSW 4 148014195 missense probably damaging 1.00
V7732:Clcn6 UTSW 4 148013955 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCCGTAAGCCTCATGTACC -3'
(R):5'- AGCTGTTGTATGTGGAGCAC -3'

Sequencing Primer
(F):5'- CCTGTTTCCTAACACATAGCTGAAG -3'
(R):5'- CACAGGGAAATAAGCACTGAGC -3'
Posted On2014-10-01