Incidental Mutation 'R2142:Gemin4'
ID236398
Institutional Source Beutler Lab
Gene Symbol Gemin4
Ensembl Gene ENSMUSG00000049396
Gene Namegem nuclear organelle associated protein 4
Synonyms
MMRRC Submission 040145-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R2142 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76210571-76217664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 76211050 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 962 (P962A)
Ref Sequence ENSEMBL: ENSMUSP00000099558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]
Predicted Effect probably benign
Transcript: ENSMUST00000094014
SMART Domains Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 249 7.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102500
AA Change: P962A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127340
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably benign
Transcript: ENSMUST00000169560
SMART Domains Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 217 4.92e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,616,675 probably null Het
Adgrb3 G T 1: 25,068,209 P640T probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Alkbh2 C T 5: 114,125,716 V77I probably benign Het
Angpt2 T C 8: 18,714,140 T129A probably benign Het
Atp6v0a4 T A 6: 38,082,936 K236* probably null Het
Baz1b G A 5: 135,217,275 R526H probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Btnl9 G T 11: 49,170,626 probably null Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cdh8 C A 8: 99,111,693 C505F probably damaging Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Ces1c T A 8: 93,130,840 I38F probably benign Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Col25a1 A G 3: 130,570,316 H546R probably damaging Het
Crot A T 5: 8,987,780 Y179N possibly damaging Het
Dck T C 5: 88,772,723 C101R probably damaging Het
Ddb1 T C 19: 10,619,126 probably null Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Elf2 A G 3: 51,256,440 V496A probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fbn1 T G 2: 125,412,708 T212P possibly damaging Het
Fuca2 A G 10: 13,505,865 Y174C probably damaging Het
Gabarap C T 11: 69,991,689 probably benign Het
Gdf2 A G 14: 33,945,241 T307A probably benign Het
Glyatl3 T C 17: 40,911,084 D93G probably benign Het
Gm266 C T 12: 111,485,181 R197K possibly damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gns G A 10: 121,392,778 R498H probably damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Grk6 T C 13: 55,454,364 W335R probably damaging Het
Helz2 T C 2: 181,231,380 E2379G probably benign Het
Hmx2 A T 7: 131,555,859 D234V probably damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTTCT 1: 135,386,282 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Itpkc A G 7: 27,219,650 V397A possibly damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat5 T A 19: 5,605,685 probably null Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kdr T C 5: 75,968,423 T188A possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Laptm4b G T 15: 34,238,332 M3I probably benign Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Man1a T C 10: 53,934,998 N338S probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Micall1 T C 15: 79,130,795 Y751H probably damaging Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myh2 A G 11: 67,189,332 E1124G probably damaging Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Nat10 T C 2: 103,731,303 probably null Het
Nipa1 C A 7: 55,997,511 probably null Het
Nrbp1 A G 5: 31,247,929 E287G possibly damaging Het
Nup188 T A 2: 30,336,706 I1165N possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1012 C T 2: 85,759,677 R233H probably benign Het
Olfr115 T G 17: 37,610,471 E93D probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1298 C A 2: 111,645,221 V259L probably benign Het
Olfr1383 A G 11: 49,523,839 I39V probably benign Het
Olfr642 C T 7: 104,050,300 G18D probably damaging Het
Olfr786 A G 10: 129,437,747 K312E probably benign Het
Optc A T 1: 133,903,796 probably null Het
Panx3 G C 9: 37,666,673 S87W probably damaging Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pcdhb11 A G 18: 37,422,123 N169D probably benign Het
Pdzd2 C A 15: 12,406,559 G605V probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Pkhd1 T A 1: 20,523,895 K1331N probably benign Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Pot1a T C 6: 25,750,044 probably null Het
Prb1 T A 6: 132,207,203 Q489L unknown Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psme4 A G 11: 30,820,998 Y782C possibly damaging Het
Rab11fip5 T C 6: 85,337,228 probably null Het
Ren1 C G 1: 133,350,778 probably null Het
Rit2 A G 18: 31,153,713 F140L probably benign Het
Rorc G A 3: 94,389,526 R271Q probably benign Het
Sall3 A T 18: 80,969,831 M1130K probably damaging Het
Sart3 T C 5: 113,764,093 E141G probably damaging Het
Serpina9 T C 12: 104,008,309 D195G probably benign Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Tarsl2 A T 7: 65,658,897 I272L probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tdpoz3 C T 3: 93,826,899 H294Y probably benign Het
Tigd4 A G 3: 84,594,363 T196A possibly damaging Het
Treh G A 9: 44,681,141 M54I probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uhrf1bp1l A G 10: 89,812,048 D207G probably damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp606 T C 7: 12,479,726 I4T probably damaging Het
Zfp638 T A 6: 83,986,596 N1918K probably damaging Het
Zfp65 G T 13: 67,708,192 H333N probably damaging Het
Other mutations in Gemin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Gemin4 APN 11 76213485 missense probably benign 0.16
IGL01654:Gemin4 APN 11 76213398 missense probably damaging 1.00
IGL01656:Gemin4 APN 11 76213810 missense probably damaging 1.00
IGL02890:Gemin4 APN 11 76211264 missense probably damaging 1.00
IGL02967:Gemin4 APN 11 76212241 missense probably damaging 1.00
R0359:Gemin4 UTSW 11 76212162 missense probably benign 0.02
R0413:Gemin4 UTSW 11 76211322 missense probably benign 0.00
R1538:Gemin4 UTSW 11 76211161 missense probably benign 0.00
R1632:Gemin4 UTSW 11 76210989 missense probably benign 0.26
R1762:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1783:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1784:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1785:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1786:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1835:Gemin4 UTSW 11 76213296 missense possibly damaging 0.62
R2007:Gemin4 UTSW 11 76212618 missense possibly damaging 0.78
R2117:Gemin4 UTSW 11 76211001 missense possibly damaging 0.59
R2131:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2133:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2140:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2141:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R3937:Gemin4 UTSW 11 76212888 missense probably damaging 1.00
R4112:Gemin4 UTSW 11 76212819 missense probably damaging 0.99
R4444:Gemin4 UTSW 11 76212091 missense probably benign 0.00
R5502:Gemin4 UTSW 11 76213401 nonsense probably null
R5702:Gemin4 UTSW 11 76210837 missense probably benign 0.01
R5744:Gemin4 UTSW 11 76212165 missense probably damaging 1.00
R6044:Gemin4 UTSW 11 76212934 missense probably benign
R6924:Gemin4 UTSW 11 76212336 missense probably damaging 1.00
R6931:Gemin4 UTSW 11 76210956 missense probably damaging 0.99
R7278:Gemin4 UTSW 11 76212106 missense probably damaging 0.98
R7286:Gemin4 UTSW 11 76212753 missense probably damaging 0.96
R7288:Gemin4 UTSW 11 76213380 missense possibly damaging 0.60
R7358:Gemin4 UTSW 11 76213452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCGATAGACTTTAAGAAGCGC -3'
(R):5'- CCAGGAACTTCAGCTCTCTG -3'

Sequencing Primer
(F):5'- ACTTTAAGAAGCGCTGCTCG -3'
(R):5'- AGCTCTCTGTTCTTTCTTTGAGAG -3'
Posted On2014-10-01