Incidental Mutation 'R2143:4930522L14Rik'
List |< first << previous [record 19 of 1871] next >> last >|
ID236482
Institutional Source Beutler Lab
Gene Symbol 4930522L14Rik
Ensembl Gene ENSMUSG00000072762
Gene NameRIKEN cDNA 4930522L14 gene
Synonyms
MMRRC Submission 040146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2143 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109735990-109751886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 109736750 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 414 (C414S)
Ref Sequence ENSEMBL: ENSMUSP00000108166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100937] [ENSMUST00000112547]
Predicted Effect probably benign
Transcript: ENSMUST00000100937
SMART Domains Protein: ENSMUSP00000098497
Gene: ENSMUSG00000072762

DomainStartEndE-ValueType
KRAB 4 64 5.37e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112547
AA Change: C414S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108166
Gene: ENSMUSG00000072762
AA Change: C414S

DomainStartEndE-ValueType
KRAB 4 66 7.19e-16 SMART
ZnF_C2H2 103 125 2.75e-3 SMART
ZnF_C2H2 131 153 1.72e-4 SMART
ZnF_C2H2 159 181 7.9e-4 SMART
ZnF_C2H2 187 209 1.04e-3 SMART
ZnF_C2H2 215 237 1.1e-2 SMART
ZnF_C2H2 243 265 3.89e-3 SMART
ZnF_C2H2 271 294 3.69e-4 SMART
ZnF_C2H2 300 322 5.9e-3 SMART
ZnF_C2H2 328 350 1.56e-2 SMART
ZnF_C2H2 356 378 1.18e-2 SMART
ZnF_C2H2 384 406 9.08e-4 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 2.61e-4 SMART
ZnF_C2H2 468 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.39e-3 SMART
ZnF_C2H2 525 547 1.4e-4 SMART
ZnF_C2H2 553 576 1.95e-3 SMART
ZnF_C2H2 582 604 5.14e-3 SMART
ZnF_C2H2 610 632 1.67e-2 SMART
ZnF_C2H2 638 660 1.72e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G C 16: 88,759,165 S89T probably benign Het
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Apobr G A 7: 126,587,116 E600K probably benign Het
Armc8 C A 9: 99,505,308 R419L probably damaging Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf7ip2 A G 16: 10,240,645 E316G probably null Het
Atp2a1 G A 7: 126,448,725 R638* probably null Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Atp8b4 A T 2: 126,374,510 I672N probably damaging Het
Atrn T C 2: 130,957,996 V431A probably benign Het
Babam1 T C 8: 71,398,440 S116P probably damaging Het
Ccdc142 T C 6: 83,102,222 L180P probably damaging Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdk17 T C 10: 93,218,019 L125P probably damaging Het
Ckap5 A G 2: 91,565,745 D531G probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Crispld1 C T 1: 17,749,636 T286I probably benign Het
Crtap T C 9: 114,379,968 Y336C probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dsg2 T A 18: 20,579,161 I118N probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Elmo3 T C 8: 105,308,673 V450A probably damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Enam T A 5: 88,492,920 M147K probably benign Het
Entpd1 T C 19: 40,736,783 Y409H probably damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fsip2 A T 2: 82,990,271 L5449F possibly damaging Het
Gabra5 G A 7: 57,489,015 T95I probably damaging Het
Gal3st2c C T 1: 94,009,451 Q373* probably null Het
Gbp5 A C 3: 142,503,832 T180P probably damaging Het
Glb1 T C 9: 114,437,824 L212P probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gpat2 T C 2: 127,433,762 F487L probably damaging Het
Hsph1 A T 5: 149,631,486 H110Q probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Ildr2 T C 1: 166,269,326 V38A probably damaging Het
Inpp4a G T 1: 37,387,746 C326F probably damaging Het
Irak2 T A 6: 113,672,827 V141D probably benign Het
Jade1 G A 3: 41,604,708 R408Q probably benign Het
Jmjd7 C A 2: 120,030,120 probably null Het
Kdm7a C T 6: 39,168,950 V348I possibly damaging Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krt5 A G 15: 101,712,359 I151T probably damaging Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc71 C T 3: 87,745,521 W148* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a T A 2: 121,301,945 S843T probably damaging Het
Map1s T A 8: 70,910,964 D48E probably damaging Het
Mast4 A G 13: 102,735,475 F2462L possibly damaging Het
Mettl21e T A 1: 44,210,238 Y86F probably benign Het
Myh6 A T 14: 54,952,954 D1035E probably damaging Het
Naip6 C T 13: 100,299,859 D719N probably damaging Het
Nat8f2 T G 6: 85,868,257 H41P probably benign Het
Ncam1 T A 9: 49,543,019 Q597L possibly damaging Het
Nek1 T A 8: 61,028,696 I215K probably damaging Het
Nol11 A T 11: 107,181,055 S237R probably benign Het
Npr2 T C 4: 43,648,166 F870S probably damaging Het
Nsd1 T C 13: 55,260,397 Y1285H probably damaging Het
Nup93 C T 8: 94,296,480 Q229* probably null Het
Olfr1234 C T 2: 89,363,103 E109K probably damaging Het
Olfr834 G A 9: 18,988,803 A272T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Parva A G 7: 112,560,067 D180G possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pax1 T A 2: 147,365,882 C225S probably damaging Het
Pde4dip T A 3: 97,888,519 E51V possibly damaging Het
Pde6c A T 19: 38,162,329 H562L probably damaging Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Polr2d T A 18: 31,796,079 L127Q probably damaging Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptpn6 T A 6: 124,724,984 H406L probably benign Het
Ric1 A T 19: 29,533,252 S78C probably damaging Het
Ric1 G A 19: 29,533,253 S78N probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Senp7 A G 16: 56,169,806 H639R probably benign Het
Sgtb A T 13: 104,124,259 D72V probably damaging Het
Slc44a5 T C 3: 154,258,449 M484T probably benign Het
Slc5a1 A G 5: 33,160,796 K598E probably benign Het
Slit3 T A 11: 35,612,261 probably null Het
Smc1b T C 15: 85,123,802 H258R probably benign Het
Smu1 T C 4: 40,744,073 D318G probably damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Svs3a C A 2: 164,289,884 S124Y probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tdpoz1 T A 3: 93,670,836 R214* probably null Het
Tm2d3 A G 7: 65,695,239 D54G probably damaging Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Triml2 T A 8: 43,193,511 W346R probably damaging Het
Trp53bp1 A T 2: 121,216,064 V1085D probably benign Het
Trpv2 T C 11: 62,592,786 V483A probably benign Het
Ugp2 G T 11: 21,328,949 N412K probably benign Het
Upf1 T C 8: 70,339,354 D407G probably null Het
Vmn2r77 C A 7: 86,811,944 P826Q probably damaging Het
Vrtn T C 12: 84,650,162 M562T probably benign Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Zdhhc6 T C 19: 55,298,796 K411E probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp280d A G 9: 72,312,729 N237S probably damaging Het
Zfp445 T G 9: 122,853,482 S465R possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Other mutations in 4930522L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:4930522L14Rik APN 5 109739235 missense possibly damaging 0.86
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0432:4930522L14Rik UTSW 5 109736919 missense probably damaging 1.00
R0463:4930522L14Rik UTSW 5 109737060 unclassified probably benign
R0891:4930522L14Rik UTSW 5 109736290 missense possibly damaging 0.47
R1289:4930522L14Rik UTSW 5 109736890 nonsense probably null
R1637:4930522L14Rik UTSW 5 109738992 missense probably benign 0.01
R1764:4930522L14Rik UTSW 5 109736789 missense probably benign 0.22
R1793:4930522L14Rik UTSW 5 109736278 missense probably damaging 1.00
R1860:4930522L14Rik UTSW 5 109736232 missense probably damaging 1.00
R1899:4930522L14Rik UTSW 5 109736798 missense probably benign 0.04
R2135:4930522L14Rik UTSW 5 109737643 missense probably benign 0.00
R2877:4930522L14Rik UTSW 5 109738945 splice site probably benign
R3847:4930522L14Rik UTSW 5 109736324 unclassified probably null
R4431:4930522L14Rik UTSW 5 109736574 missense possibly damaging 0.47
R4578:4930522L14Rik UTSW 5 109736671 nonsense probably null
R4611:4930522L14Rik UTSW 5 109737393 missense probably benign 0.00
R4776:4930522L14Rik UTSW 5 109736873 missense probably benign 0.22
R4921:4930522L14Rik UTSW 5 109737796 missense probably benign 0.25
R4937:4930522L14Rik UTSW 5 109736201 missense probably benign 0.12
R4952:4930522L14Rik UTSW 5 109739197 critical splice donor site probably null
R4980:4930522L14Rik UTSW 5 109737426 missense probably damaging 1.00
R5079:4930522L14Rik UTSW 5 109737330 missense probably benign
R5088:4930522L14Rik UTSW 5 109736073 missense probably damaging 1.00
R5143:4930522L14Rik UTSW 5 109739198 critical splice donor site probably null
R5183:4930522L14Rik UTSW 5 109739305 missense probably damaging 1.00
R5461:4930522L14Rik UTSW 5 109736777 missense possibly damaging 0.74
R5498:4930522L14Rik UTSW 5 109737547 missense probably benign 0.05
R5576:4930522L14Rik UTSW 5 109737704 missense probably benign 0.00
R6081:4930522L14Rik UTSW 5 109739231 missense probably damaging 1.00
R6387:4930522L14Rik UTSW 5 109737015 missense possibly damaging 0.88
R6509:4930522L14Rik UTSW 5 109737384 nonsense probably null
R6585:4930522L14Rik UTSW 5 109737668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGATCACACTTGTAAGGTGTC -3'
(R):5'- TGATCAGTGTGGTAAAGGCTTTGC -3'

Sequencing Primer
(F):5'- ACACTTGTAAGGTGTCTCTTCAG -3'
(R):5'- CCCTATGAATGTAAGCAATGTGGC -3'
Posted On2014-10-01