Incidental Mutation 'R2143:Nek1'
ID236505
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 040146-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2143 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61028696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 215 (I215K)
Ref Sequence ENSEMBL: ENSMUSP00000147809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably damaging
Transcript: ENSMUST00000034065
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: I215K

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120689
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: I215K

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210310
Predicted Effect probably damaging
Transcript: ENSMUST00000211256
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211672
AA Change: I215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G C 16: 88,759,165 S89T probably benign Het
4930522L14Rik C G 5: 109,736,750 C414S probably damaging Het
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Apobr G A 7: 126,587,116 E600K probably benign Het
Armc8 C A 9: 99,505,308 R419L probably damaging Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf7ip2 A G 16: 10,240,645 E316G probably null Het
Atp2a1 G A 7: 126,448,725 R638* probably null Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Atp8b4 A T 2: 126,374,510 I672N probably damaging Het
Atrn T C 2: 130,957,996 V431A probably benign Het
Babam1 T C 8: 71,398,440 S116P probably damaging Het
Ccdc142 T C 6: 83,102,222 L180P probably damaging Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdk17 T C 10: 93,218,019 L125P probably damaging Het
Ckap5 A G 2: 91,565,745 D531G probably benign Het
Cntn5 G T 9: 9,748,415 P487Q probably damaging Het
Crispld1 C T 1: 17,749,636 T286I probably benign Het
Crtap T C 9: 114,379,968 Y336C probably damaging Het
Ctu2 T A 8: 122,479,152 I213K probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dsg2 T A 18: 20,579,161 I118N probably damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Elmo3 T C 8: 105,308,673 V450A probably damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Enam T A 5: 88,492,920 M147K probably benign Het
Entpd1 T C 19: 40,736,783 Y409H probably damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fbn2 A G 18: 58,052,993 V1761A possibly damaging Het
Fsip2 A T 2: 82,990,271 L5449F possibly damaging Het
Gabra5 G A 7: 57,489,015 T95I probably damaging Het
Gal3st2c C T 1: 94,009,451 Q373* probably null Het
Gbp5 A C 3: 142,503,832 T180P probably damaging Het
Glb1 T C 9: 114,437,824 L212P probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gpat2 T C 2: 127,433,762 F487L probably damaging Het
Hsph1 A T 5: 149,631,486 H110Q probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Ildr2 T C 1: 166,269,326 V38A probably damaging Het
Inpp4a G T 1: 37,387,746 C326F probably damaging Het
Irak2 T A 6: 113,672,827 V141D probably benign Het
Jade1 G A 3: 41,604,708 R408Q probably benign Het
Jmjd7 C A 2: 120,030,120 probably null Het
Kdm7a C T 6: 39,168,950 V348I possibly damaging Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krt5 A G 15: 101,712,359 I151T probably damaging Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc71 C T 3: 87,745,521 W148* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a T A 2: 121,301,945 S843T probably damaging Het
Map1s T A 8: 70,910,964 D48E probably damaging Het
Mast4 A G 13: 102,735,475 F2462L possibly damaging Het
Mettl21e T A 1: 44,210,238 Y86F probably benign Het
Myh6 A T 14: 54,952,954 D1035E probably damaging Het
Naip6 C T 13: 100,299,859 D719N probably damaging Het
Nat8f2 T G 6: 85,868,257 H41P probably benign Het
Ncam1 T A 9: 49,543,019 Q597L possibly damaging Het
Nol11 A T 11: 107,181,055 S237R probably benign Het
Npr2 T C 4: 43,648,166 F870S probably damaging Het
Nsd1 T C 13: 55,260,397 Y1285H probably damaging Het
Nup93 C T 8: 94,296,480 Q229* probably null Het
Olfr1234 C T 2: 89,363,103 E109K probably damaging Het
Olfr834 G A 9: 18,988,803 A272T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Parva A G 7: 112,560,067 D180G possibly damaging Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pax1 T A 2: 147,365,882 C225S probably damaging Het
Pde4dip T A 3: 97,888,519 E51V possibly damaging Het
Pde6c A T 19: 38,162,329 H562L probably damaging Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Polr2d T A 18: 31,796,079 L127Q probably damaging Het
Prkd1 A G 12: 50,489,911 V130A possibly damaging Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptpn13 A G 5: 103,556,133 T1344A probably benign Het
Ptpn6 T A 6: 124,724,984 H406L probably benign Het
Ric1 A T 19: 29,533,252 S78C probably damaging Het
Ric1 G A 19: 29,533,253 S78N probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Senp7 A G 16: 56,169,806 H639R probably benign Het
Sgtb A T 13: 104,124,259 D72V probably damaging Het
Slc44a5 T C 3: 154,258,449 M484T probably benign Het
Slc5a1 A G 5: 33,160,796 K598E probably benign Het
Slit3 T A 11: 35,612,261 probably null Het
Smc1b T C 15: 85,123,802 H258R probably benign Het
Smu1 T C 4: 40,744,073 D318G probably damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
Svs3a C A 2: 164,289,884 S124Y probably damaging Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tdpoz1 T A 3: 93,670,836 R214* probably null Het
Tm2d3 A G 7: 65,695,239 D54G probably damaging Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Triml2 T A 8: 43,193,511 W346R probably damaging Het
Trp53bp1 A T 2: 121,216,064 V1085D probably benign Het
Trpv2 T C 11: 62,592,786 V483A probably benign Het
Ugp2 G T 11: 21,328,949 N412K probably benign Het
Upf1 T C 8: 70,339,354 D418G probably null Het
Vmn2r77 C A 7: 86,811,944 P826Q probably damaging Het
Vrtn T C 12: 84,650,162 M562T probably benign Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Zdhhc6 T C 19: 55,298,796 K411E probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp280d A G 9: 72,312,729 N237S probably damaging Het
Zfp445 T G 9: 122,853,482 S465R possibly damaging Het
Zfp821 A G 8: 109,724,347 D324G probably damaging Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACCTTACCTCTTGGCATG -3'
(R):5'- TGTGACACATACCTGAGGGG -3'

Sequencing Primer
(F):5'- ACCTCTTGGCATGTTGCATAAACAC -3'
(R):5'- CATACCTGAGGGGAGAGAAACTTTTC -3'
Posted On2014-10-01