Incidental Mutation 'R2144:Fbn2'
ID236698
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 040147-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R2144 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58052993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1761 (V1761A)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025497
AA Change: V1761A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: V1761A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik G A 4: 88,868,174 T69I unknown Het
4930553M12Rik T A 4: 88,868,175 T69S unknown Het
Acsl6 A T 11: 54,341,778 Q485L probably damaging Het
Adam5 C A 8: 24,815,480 V81F probably benign Het
Armc4 C T 18: 7,127,229 E995K probably damaging Het
Atp5s A G 12: 69,741,054 Q88R probably damaging Het
Bag2 A G 1: 33,746,831 S137P possibly damaging Het
Birc6 A T 17: 74,660,413 Q4103L possibly damaging Het
Camta2 A G 11: 70,671,575 F999L probably benign Het
Cap2 A T 13: 46,560,502 probably null Het
Ccnk T A 12: 108,189,090 L102Q probably null Het
Cd52 T C 4: 134,093,737 probably benign Het
Cdc123 A T 2: 5,810,806 I160K probably benign Het
Cep85l T C 10: 53,358,126 N52S probably benign Het
Cntnap5a C T 1: 116,101,710 T298I probably benign Het
Cpsf4 G T 5: 145,178,762 S192I probably benign Het
Cpxm1 A G 2: 130,397,410 S33P probably benign Het
Cyp2a12 A T 7: 27,034,769 T376S possibly damaging Het
Cyp3a16 A G 5: 145,456,084 F137S probably damaging Het
Des A G 1: 75,366,804 T444A probably benign Het
Dgcr8 C T 16: 18,284,256 G54D probably damaging Het
Doxl2 A G 6: 48,975,291 H50R probably benign Het
Dsc3 A G 18: 19,980,686 F393S possibly damaging Het
Dstyk T A 1: 132,463,375 M838K probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Eml5 A C 12: 98,810,605 F1417C probably damaging Het
Ep400 A T 5: 110,703,518 M1366K unknown Het
Epg5 G T 18: 77,954,197 C425F possibly damaging Het
Epha3 C G 16: 63,773,317 R136P possibly damaging Het
Extl1 C A 4: 134,371,044 E225D probably benign Het
Fam186b A G 15: 99,280,657 Y263H probably benign Het
Fer1l6 T A 15: 58,627,534 M1251K probably benign Het
Gart A T 16: 91,630,081 I555N probably damaging Het
Gm11596 A T 11: 99,792,963 C110* probably null Het
Gnptab C T 10: 88,428,506 S262L possibly damaging Het
Gpr21 T C 2: 37,518,231 V263A probably benign Het
Gxylt1 T C 15: 93,254,480 I224V probably benign Het
H2-Aa A G 17: 34,283,827 S122P probably damaging Het
Hsph1 A C 5: 149,630,337 probably null Het
Hunk G A 16: 90,432,532 D94N probably damaging Het
Ikbke C A 1: 131,273,474 V176L probably damaging Het
Inpp5k A T 11: 75,647,191 probably null Het
Ints10 A G 8: 68,796,805 T96A probably damaging Het
Kansl2 A T 15: 98,526,631 V306E probably benign Het
Kif20a A G 18: 34,625,604 D42G possibly damaging Het
Klhl7 A T 5: 24,100,863 M37L probably benign Het
Krtap1-5 T C 11: 99,580,818 I50V probably benign Het
Ktn1 A G 14: 47,714,652 E983G probably damaging Het
Lrrk1 G A 7: 66,296,163 S566L probably damaging Het
M6pr A G 6: 122,315,367 M174V probably benign Het
Man2a2 A G 7: 80,363,516 S510P probably damaging Het
Mmrn1 G A 6: 60,945,075 S172N possibly damaging Het
Mpv17 A G 5: 31,154,189 probably null Het
Mrgpra9 T C 7: 47,235,463 E152G probably benign Het
Mst1r T C 9: 107,913,168 V660A probably benign Het
Myof A G 19: 37,981,221 probably null Het
Myrf G A 19: 10,228,674 P126L probably benign Het
Nckap1l C T 15: 103,475,676 A567V probably damaging Het
Nphs1 A G 7: 30,460,970 E169G probably benign Het
Npy1r T A 8: 66,705,184 V382D probably benign Het
Nrl A T 14: 55,520,850 M140K possibly damaging Het
Olfr1305 A G 2: 111,873,423 I144T probably damaging Het
Olfr199 C T 16: 59,216,026 V196M probably benign Het
Olfr292 T A 7: 86,695,280 F275I probably damaging Het
Olfr694 A T 7: 106,688,957 M258K probably damaging Het
Olfr924 C T 9: 38,848,339 T75I probably damaging Het
Orc5 T A 5: 22,547,927 L36F possibly damaging Het
Osbpl1a A T 18: 12,871,173 S396T probably benign Het
Pappa T A 4: 65,180,949 Y568* probably null Het
Pask C T 1: 93,321,297 A794T probably benign Het
Pclo C T 5: 14,858,752 L5025F unknown Het
Pde3a T C 6: 141,490,111 V924A probably benign Het
Pdpr A G 8: 111,118,036 N355S probably damaging Het
Pepd A T 7: 34,921,418 K36M probably benign Het
Pet100 T G 8: 3,622,355 L14R probably damaging Het
Pfkfb2 T C 1: 130,698,723 T438A probably benign Het
Pik3r6 T A 11: 68,543,611 L546* probably null Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Plxdc1 T C 11: 97,934,012 Y339C probably damaging Het
Primpol A T 8: 46,586,343 M414K probably damaging Het
Prol1 A T 5: 88,328,395 T215S unknown Het
Prss22 A G 17: 23,994,682 Y212H probably damaging Het
Ralgapa2 C A 2: 146,388,604 V1014L probably damaging Het
Rap1gap2 G A 11: 74,425,976 T245M probably damaging Het
Rbm26 T A 14: 105,115,202 R1009* probably null Het
Rbm42 A G 7: 30,641,110 *450Q probably null Het
Rere T C 4: 150,616,931 V1256A probably damaging Het
Rmi1 G T 13: 58,407,983 L15F probably damaging Het
Rnf213 T C 11: 119,443,690 S3242P probably damaging Het
Rtel1 T A 2: 181,323,706 V167E probably damaging Het
Scgb1b2 G T 7: 31,291,763 probably benign Het
Sin3b T C 8: 72,731,265 L203P probably damaging Het
Skint6 T C 4: 113,236,260 S229G possibly damaging Het
Slco1a4 T C 6: 141,809,378 Y566C probably damaging Het
Smgc T G 15: 91,844,421 D121E possibly damaging Het
Sned1 T A 1: 93,271,684 F495L probably damaging Het
St7 A T 6: 17,886,007 N52I possibly damaging Het
Sycn C A 7: 28,541,069 Q54K probably benign Het
Syngr4 A G 7: 45,887,040 V186A probably benign Het
Tarsl2 G A 7: 65,655,791 M254I possibly damaging Het
Tcaf2 A T 6: 42,642,804 H96Q probably benign Het
Tcp11l2 T C 10: 84,613,499 Y443H probably damaging Het
Tmem200c A T 17: 68,842,249 Q609L possibly damaging Het
Tmx3 G A 18: 90,517,490 G83R probably damaging Het
Tpgs2 A C 18: 25,168,541 V23G possibly damaging Het
Trhr T C 15: 44,197,183 V33A probably benign Het
Trim66 A T 7: 109,475,113 I647N probably damaging Het
Trnt1 A G 6: 106,778,039 K244E probably damaging Het
Tsfm G A 10: 127,028,445 Q134* probably null Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vmn2r78 C T 7: 86,954,482 L623F probably damaging Het
Wdr55 A G 18: 36,762,366 N132S possibly damaging Het
Wipf2 A T 11: 98,896,214 R356S possibly damaging Het
Wnk1 A G 6: 119,948,988 probably benign Het
Zfp260 A G 7: 30,105,340 K222E probably damaging Het
Zfp300 A G X: 21,081,951 S525P possibly damaging Het
Zfp592 A G 7: 81,038,202 T959A probably benign Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGAGTACATACCCACTATGAC -3'
(R):5'- TTGTGTCACTCAGGAAAGCTGG -3'

Sequencing Primer
(F):5'- AGTGTATCACTGGCAAAGCCTCTC -3'
(R):5'- TCACTCAGGAAAGCTGGCTGAG -3'
Posted On2014-10-01