Incidental Mutation 'R0973:Adamts20'
ID236752
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission 039102-MU
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94286371 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1517 (Q1517L)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342]
Predicted Effect probably benign
Transcript: ENSMUST00000035342
AA Change: Q1517L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: Q1517L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930503L19Rik T A 18: 70,467,926 Q295L probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Atad2b A G 12: 5,031,784 N1231S probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L771* probably null Het
Atp8b3 T C 10: 80,534,198 N127S probably damaging Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Birc6 T A 17: 74,565,861 S372T probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cdh18 T A 15: 23,473,995 D650E probably damaging Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Cep152 A G 2: 125,594,899 S574P probably benign Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cib4 T C 5: 30,488,594 D110G probably damaging Het
Col9a2 T A 4: 121,039,788 probably null Het
Csmd2 A T 4: 128,496,188 I2239F possibly damaging Het
Csmd3 C A 15: 47,659,089 G2728V probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Cyp2d11 A G 15: 82,389,529 L416P possibly damaging Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Depdc5 T A 5: 32,986,966 M1435K possibly damaging Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dld A T 12: 31,334,054 I350N probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Gm13084 T C 4: 143,811,858 Y181C probably damaging Het
Gm4847 A G 1: 166,630,255 S510P probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ibtk T C 9: 85,743,577 Y40C probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Ift172 C T 5: 31,265,355 R917H probably benign Het
Itgae C T 11: 73,138,509 Q1037* probably null Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Macf1 A G 4: 123,476,000 V91A possibly damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Mark1 A C 1: 184,921,604 V167G probably damaging Het
Mrgprf T A 7: 145,308,256 L185Q probably damaging Het
Mtor T A 4: 148,550,188 V2422D probably damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S185R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Olfr912 T A 9: 38,581,283 V2D possibly damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Pde1c A G 6: 56,361,815 F11L probably benign Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Piezo2 T C 18: 63,015,802 Y2659C probably damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Plxnb1 T C 9: 109,102,142 V410A possibly damaging Het
Ptger2 A G 14: 44,989,500 Y179C probably damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Rcan1 A T 16: 92,393,520 M177K probably benign Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpa1 C T 11: 75,312,973 probably null Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Sel1l T C 12: 91,824,860 Y359C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,160,703 probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Spef2 A G 15: 9,716,396 F368S probably damaging Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Stat4 A G 1: 52,096,820 I429M probably damaging Het
Stkld1 A T 2: 26,951,450 Q469L probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Tmem81 G A 1: 132,507,924 R156Q probably damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Vmn1r120 A G 7: 21,053,016 C257R probably damaging Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Vwf A G 6: 125,643,006 E1549G probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 splice acceptor site
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6417:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTCACACCGTGACGTCAC -3'
(R):5'- AAGGAAACGTGCAATGCTCTG -3'

Sequencing Primer
(F):5'- GTGACGTCACACATACACATTC -3'
(R):5'- AAACGTGCAATGCTCTGTTTTGC -3'
Posted OnOct 02, 2014