Incidental Mutation 'R0973:Adamts20'
ID236752
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission 039102-MU
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94286371 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1517 (Q1517L)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342]
Predicted Effect probably benign
Transcript: ENSMUST00000035342
AA Change: Q1517L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: Q1517L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
AL627093.1 A T 4: 128,496,188 I2239F probably benign Het
Arhgef7 A G 8: 11,819,659 T432A probably damaging Het
Atad2b A G 12: 5,031,784 N1231S probably benign Het
Atp8b3 T C 10: 80,534,198 N127S probably damaging Het
Birc6 T A 17: 74,565,861 S372T probably damaging Het
Cdh18 T A 15: 23,473,995 D650E probably damaging Het
Cib4 T C 5: 30,488,594 D110G probably damaging Het
Col9a2 T A 4: 121,039,788 probably null Het
Csmd3 C A 15: 47,659,089 G2728V probably damaging Het
Cyp2d11 A G 15: 82,389,529 L416P possibly damaging Het
Depdc5 T A 5: 32,986,966 M1435K possibly damaging Het
Dld A T 12: 31,334,054 I350N probably damaging Het
Gm13084 T C 4: 143,811,858 Y181C probably damaging Het
Gm4847 A G 1: 166,630,255 S510P probably benign Het
Ibtk T C 9: 85,743,577 Y40C probably damaging Het
Ift172 C T 5: 31,265,355 R917H probably benign Het
Itgae C T 11: 73,138,509 Q1037* probably null Het
Macf1 A G 4: 123,476,000 V91A possibly damaging Het
Mark1 A C 1: 184,921,604 V167G probably damaging Het
Mmp21 A G 7: 133,677,671 noncoding transcript Het
Mrgprf T A 7: 145,308,256 L185Q probably damaging Het
Mrrf T C 2: 36,153,578 noncoding transcript Het
Mtor T A 4: 148,550,188 V2422D probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfr912 T A 9: 38,581,283 V2D possibly damaging Het
Pde1c A G 6: 56,361,815 F11L probably benign Het
Piezo2 T C 18: 63,015,802 Y2659C probably damaging Het
Plxnb1 T C 9: 109,102,142 V410A possibly damaging Het
Ptger2 A G 14: 44,989,500 Y179C probably damaging Het
Ptpro T A 6: 137,443,594 V1035D probably damaging Het
Rcan1 A T 16: 92,393,520 M230K probably benign Het
Rpa1 C T 11: 75,312,973 probably null Het
Ryr1 T C 7: 29,095,051 Het
Sel1l T C 12: 91,824,860 Y359C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,160,703 probably benign Het
Spef2 A G 15: 9,716,396 F368S probably damaging Het
Stat4 A G 1: 52,096,820 I429M probably damaging Het
Stkld1 A T 2: 26,951,450 Q469L probably benign Het
Tmem81 G A 1: 132,507,924 R156Q probably damaging Het
Vmn1r120 A G 7: 21,053,016 C257R probably damaging Het
Vmn2r84 T G 10: 130,390,662 Het
Vwf A G 6: 125,643,006 E1552G noncoding transcript Het
Xpo7 A T 14: 70,669,487 Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 synonymous probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTCACACCGTGACGTCAC -3'
(R):5'- AAGGAAACGTGCAATGCTCTG -3'

Sequencing Primer
(F):5'- GTGACGTCACACATACACATTC -3'
(R):5'- AAACGTGCAATGCTCTGTTTTGC -3'
Posted OnOct 02, 2014