Incidental Mutation 'R0973:Rcan1'
ID236753
Institutional Source Beutler Lab
Gene Symbol Rcan1
Ensembl Gene ENSMUSG00000022951
Gene Nameregulator of calcineurin 1
SynonymsMCIP1, 2410048A02Rik, ADAPT78, Dscr1, CSP1
MMRRC Submission 039102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0973 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92391953-92470867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92393520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 177 (M177K)
Ref Sequence ENSEMBL: ENSMUSP00000023672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023672] [ENSMUST00000060005] [ENSMUST00000231410] [ENSMUST00000231813] [ENSMUST00000232197] [ENSMUST00000232239]
Predicted Effect probably benign
Transcript: ENSMUST00000023672
AA Change: M177K

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023672
Gene: ENSMUSG00000022951
AA Change: M177K

DomainStartEndE-ValueType
Pfam:Calcipressin 20 192 1.2e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000060005
AA Change: M230K
SMART Domains Protein: ENSMUSP00000060394
Gene: ENSMUSG00000022951
AA Change: M230K

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 39 46 N/A INTRINSIC
Pfam:Calcipressin 73 245 3.8e-65 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231410
AA Change: M97K
Predicted Effect unknown
Transcript: ENSMUST00000231813
AA Change: M38K
Predicted Effect unknown
Transcript: ENSMUST00000232197
AA Change: M97K
Predicted Effect unknown
Transcript: ENSMUST00000232239
AA Change: M177K
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Unstressed homozygous mutant mice show no overt phenotype other than a slight reduction in heart size and an impaired T helper 1 response. Stress-induced cardiac hypertrophy, however, is attenuated in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
Adamts20 T A 15: 94,286,371 Q1517L probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Atad2b A G 12: 5,031,784 N1231S probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
Atp8b3 T C 10: 80,534,198 N127S probably damaging Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Birc6 T A 17: 74,565,861 S372T probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cdh18 T A 15: 23,473,995 D650E probably damaging Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Cep152 A G 2: 125,594,899 S574P probably benign Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Cib4 T C 5: 30,488,594 D110G probably damaging Het
Col9a2 T A 4: 121,039,788 probably null Het
Csmd2 A T 4: 128,496,188 I2239F possibly damaging Het
Csmd3 C A 15: 47,659,089 G2728V probably damaging Het
Cxcl1 A T 5: 90,891,767 K85* probably null Het
Cyp2d11 A G 15: 82,389,529 L416P possibly damaging Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Depdc5 T A 5: 32,986,966 M1435K possibly damaging Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dld A T 12: 31,334,054 I350N probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Gm13084 T C 4: 143,811,858 Y181C probably damaging Het
Gm4847 A G 1: 166,630,255 S510P probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ibtk T C 9: 85,743,577 Y40C probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Ift172 C T 5: 31,265,355 R917H probably benign Het
Itgae C T 11: 73,138,509 Q1037* probably null Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Macf1 A G 4: 123,476,000 V91A possibly damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Mark1 A C 1: 184,921,604 V167G probably damaging Het
Mrgprf T A 7: 145,308,256 L185Q probably damaging Het
Mtor T A 4: 148,550,188 V2422D probably damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Olfr912 T A 9: 38,581,283 V2D possibly damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Pde1c A G 6: 56,361,815 F11L probably benign Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Piezo2 T C 18: 63,015,802 Y2659C probably damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Plxnb1 T C 9: 109,102,142 V410A possibly damaging Het
Ptger2 A G 14: 44,989,500 Y179C probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpa1 C T 11: 75,312,973 probably null Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Sel1l T C 12: 91,824,860 Y309C probably damaging Het
Setd1b GCCCCCCC GCCCCCCCCCCCCC 5: 123,160,703 probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Spef2 A G 15: 9,716,396 F368S probably damaging Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Stat4 A G 1: 52,096,820 I429M probably damaging Het
Stkld1 A T 2: 26,951,450 Q469L probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Tmem81 G A 1: 132,507,924 R156Q probably damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Vmn1r120 A G 7: 21,053,016 C257R probably damaging Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Vwf A G 6: 125,643,006 E1549G probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Rcan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0944:Rcan1 UTSW 16 92393491 missense probably damaging 1.00
R2303:Rcan1 UTSW 16 92393596 missense possibly damaging 0.80
R2340:Rcan1 UTSW 16 92397352 missense probably damaging 1.00
R3907:Rcan1 UTSW 16 92466029 utr 5 prime probably benign
R4352:Rcan1 UTSW 16 92393496 missense probably benign 0.11
R4857:Rcan1 UTSW 16 92465906 missense possibly damaging 0.77
R6072:Rcan1 UTSW 16 92465927 missense probably benign 0.01
R6991:Rcan1 UTSW 16 92397363 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AACTGGAATTTCTGCCACAGTGG -3'
(R):5'- CTGTGTCTGGCCAAGCAAAC -3'

Sequencing Primer
(F):5'- GAATTTCTGCCACAGTGGTCACG -3'
(R):5'- GCCAAGCAAACCCTGGTGTC -3'
Posted On2014-10-02