Incidental Mutation 'R2175:Smarcc1'
ID236833
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission 040177-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2175 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110164809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 241 (T241S)
Ref Sequence ENSEMBL: ENSMUSP00000143550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000197480] [ENSMUST00000197984] [ENSMUST00000199896]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088716
AA Change: T241S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481
AA Change: T241S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197480
AA Change: T241S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142629
Gene: ENSMUSG00000032481
AA Change: T241S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197984
AA Change: T241S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481
AA Change: T241S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199896
AA Change: T241S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481
AA Change: T241S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200237
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Alox8 T C 11: 69,187,766 Y367C possibly damaging Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cox10 G A 11: 64,071,649 A122V probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Fam151b T C 13: 92,477,918 R21G probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Hdac1 G A 4: 129,534,670 R36C probably damaging Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Nkx1-1 G A 5: 33,431,254 A230V probably benign Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110237808 splice site probably null
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 110118343 unclassified probably benign
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110196320 missense probably damaging 1.00
R7068:Smarcc1 UTSW 9 110185884 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTGGGCAGCATCTATTTAGAATTC -3'
(R):5'- GCCAGAGTGACAACAGCTTTC -3'

Sequencing Primer
(F):5'- GAAAAGTCAGGTCTCCTACTTGTGC -3'
(R):5'- ATGTGTGCCTAGTCAACACG -3'
Posted On2014-10-02