Incidental Mutation 'R2175:Cox10'
ID236834
Institutional Source Beutler Lab
Gene Symbol Cox10
Ensembl Gene ENSMUSG00000042148
Gene Namecytochrome c oxidase assembly protein 10
Synonyms
MMRRC Submission 040177-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R2175 (G1)
Quality Score214
Status Not validated
Chromosome11
Chromosomal Location63962627-64079468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64071649 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 122 (A122V)
Ref Sequence ENSEMBL: ENSMUSP00000040138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049091]
Predicted Effect probably benign
Transcript: ENSMUST00000049091
AA Change: A122V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040138
Gene: ENSMUSG00000042148
AA Change: A122V

DomainStartEndE-ValueType
Pfam:UbiA 168 418 5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a A G 19: 54,046,362 T50A probably benign Het
Alox8 T C 11: 69,187,766 Y367C possibly damaging Het
Ankfn1 A G 11: 89,526,537 L83P probably damaging Het
Asxl3 T C 18: 22,516,595 L547P probably benign Het
Cttnbp2 A C 6: 18,434,829 probably null Het
Eml5 A T 12: 98,876,223 C205* probably null Het
Ephx3 T A 17: 32,188,459 T204S possibly damaging Het
Evi5l A G 8: 4,187,269 H124R probably damaging Het
Ext1 G T 15: 53,068,728 P726Q probably damaging Het
Fam151b T C 13: 92,477,918 R21G probably damaging Het
Gm5346 T A 8: 43,625,438 Y583F probably benign Het
Hdac1 G A 4: 129,534,670 R36C probably damaging Het
Ift172 A G 5: 31,266,685 Y715H probably damaging Het
Inpp4b T C 8: 81,856,699 F144S probably damaging Het
Lepr T A 4: 101,765,379 I452N probably benign Het
Mok T C 12: 110,815,200 H6R probably benign Het
Myef2 A T 2: 125,098,455 M392K probably damaging Het
Ncoa2 G A 1: 13,224,613 P28S probably damaging Het
Nfrkb A G 9: 31,389,014 T34A possibly damaging Het
Nkx1-1 G A 5: 33,431,254 A230V probably benign Het
Olfr1123 T A 2: 87,418,156 L34H probably damaging Het
Olfr1437 T A 19: 12,322,521 Y102F probably damaging Het
Ryr1 T G 7: 29,068,442 K2890T probably damaging Het
Siae G T 9: 37,627,796 D168Y probably damaging Het
Smarcc1 A T 9: 110,164,809 T241S possibly damaging Het
Steap2 T A 5: 5,673,501 I460F probably damaging Het
Strap A G 6: 137,750,592 T345A probably benign Het
Tex2 A G 11: 106,503,687 V1099A unknown Het
Thsd7a T C 6: 12,331,944 T1290A possibly damaging Het
Unc80 G A 1: 66,677,355 G2878D probably damaging Het
Vmn2r63 C T 7: 42,933,580 probably null Het
Xirp2 C T 2: 67,509,914 T833I probably damaging Het
Zcchc2 T C 1: 106,027,423 S615P probably damaging Het
Zfp148 C G 16: 33,496,746 S554* probably null Het
Other mutations in Cox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02746:Cox10 APN 11 63964531 splice site probably benign
PIT4504001:Cox10 UTSW 11 63964216 missense possibly damaging 0.66
R0548:Cox10 UTSW 11 63976352 missense probably damaging 1.00
R0811:Cox10 UTSW 11 64071713 missense probably benign
R0812:Cox10 UTSW 11 64071713 missense probably benign
R4290:Cox10 UTSW 11 63964255 missense probably benign 0.00
R4681:Cox10 UTSW 11 63976451 missense possibly damaging 0.94
R4770:Cox10 UTSW 11 63964163 missense probably benign 0.00
R5873:Cox10 UTSW 11 64071686 missense probably benign 0.00
R6457:Cox10 UTSW 11 63964372 missense probably damaging 0.99
X0064:Cox10 UTSW 11 63993957 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATGAGTTTCAAAGTTTAAGGGACG -3'
(R):5'- CTGTCTAGTATGTCACACAGCTGC -3'

Sequencing Primer
(F):5'- ACGTAGTAAATCCAGCTCAGTAG -3'
(R):5'- TAGTATGTCACACAGCTGCACAGG -3'
Posted On2014-10-02