Incidental Mutation 'R2176:Olfr1248'
ID236855
Institutional Source Beutler Lab
Gene Symbol Olfr1248
Ensembl Gene ENSMUSG00000111239
Gene Nameolfactory receptor 1248
SynonymsMOR231-10, GA_x6K02T2Q125-51059648-51058725
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89617168-89618245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89617580 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 204 (M204K)
Ref Sequence ENSEMBL: ENSMUSP00000140045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111532] [ENSMUST00000186710] [ENSMUST00000216129] [ENSMUST00000216424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099770
AA Change: M204K

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097358
Gene: ENSMUSG00000075080
AA Change: M204K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111532
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186710
AA Change: M204K

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: M204K

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216129
AA Change: M204K

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216424
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Olfr1248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02871:Olfr1248 APN 2 89618160 missense probably benign 0.00
PIT4431001:Olfr1248 UTSW 2 89617857 missense probably benign 0.00
R0504:Olfr1248 UTSW 2 89618094 missense probably damaging 1.00
R0761:Olfr1248 UTSW 2 89617835 missense probably damaging 1.00
R3722:Olfr1248 UTSW 2 89618159 missense possibly damaging 0.88
R4030:Olfr1248 UTSW 2 89617863 missense probably damaging 0.99
R4440:Olfr1248 UTSW 2 89618168 missense probably damaging 1.00
R4756:Olfr1248 UTSW 2 89617470 missense possibly damaging 0.86
R4981:Olfr1248 UTSW 2 89617425 missense probably damaging 1.00
R5678:Olfr1248 UTSW 2 89617281 missense probably benign
R6503:Olfr1248 UTSW 2 89617578 missense possibly damaging 0.76
R6569:Olfr1248 UTSW 2 89618015 missense possibly damaging 0.83
R6770:Olfr1248 UTSW 2 89617862 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTGGAAAGTTGGAGATAGGTCTAAC -3'
(R):5'- TCTGACCATAATGAAACGGCAGG -3'

Sequencing Primer
(F):5'- AGTTGGAGATAGGTCTAACATACATG -3'
(R):5'- CAGGTTTGCATTCTCTTGGTG -3'
Posted On2014-10-02