Incidental Mutation 'R2176:Focad'
ID236863
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88279244 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 625 (Y625N)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: Y711N
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: Y711N

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: Y625N
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: Y625N

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTTGATGCTGATCAGTCACTCTTAC -3'
(R):5'- TGCATGGGAGCTACACCTAC -3'

Sequencing Primer
(F):5'- TGAGAACCAGTTTCTTTTCTCAAGTG -3'
(R):5'- ACAGGTACATATATACACTCATCAGG -3'
Posted On2014-10-02