Incidental Mutation 'R2176:Myo15b'
ID236891
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115866572 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1083 (W1083R)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
Predicted Effect probably damaging
Transcript: ENSMUST00000093911
AA Change: W1083R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: W1083R

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGCTGAAGTAACCAC -3'
(R):5'- ATAGCCTGCTTGTCTCCCAG -3'

Sequencing Primer
(F):5'- GCTGAAGTAACCACAGGAAGACC -3'
(R):5'- TGCTTGTCTCCCAGGAAGC -3'
Posted On2014-10-02