Incidental Mutation 'R2176:Ccr6'
ID236908
Institutional Source Beutler Lab
Gene Symbol Ccr6
Ensembl Gene ENSMUSG00000040899
Gene Namechemokine (C-C motif) receptor 6
SynonymsCmkbr6
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2176 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8236043-8257141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8256241 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 93 (F93I)
Ref Sequence ENSEMBL: ENSMUSP00000156324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]
Predicted Effect probably damaging
Transcript: ENSMUST00000097418
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164411
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166348
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167956
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177568
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 8.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180103
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: F93I

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231340
Predicted Effect probably damaging
Transcript: ENSMUST00000231545
AA Change: F93I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232412
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Noct G A 3: 51,249,696 probably null Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Ccr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ccr6 APN 17 8255993 missense probably benign 0.07
IGL02227:Ccr6 APN 17 8256452 missense probably damaging 1.00
IGL02339:Ccr6 APN 17 8256253 missense probably benign 0.01
E0374:Ccr6 UTSW 17 8256452 missense probably damaging 1.00
R0021:Ccr6 UTSW 17 8256766 missense possibly damaging 0.46
R0976:Ccr6 UTSW 17 8256422 missense probably damaging 1.00
R0980:Ccr6 UTSW 17 8256014 missense probably benign 0.00
R1141:Ccr6 UTSW 17 8256002 missense probably damaging 1.00
R1674:Ccr6 UTSW 17 8256217 missense probably damaging 0.99
R2117:Ccr6 UTSW 17 8256082 missense possibly damaging 0.75
R4736:Ccr6 UTSW 17 8256064 nonsense probably null
R5050:Ccr6 UTSW 17 8256104 missense probably damaging 1.00
R5786:Ccr6 UTSW 17 8256412 missense probably damaging 0.99
R6138:Ccr6 UTSW 17 8256382 missense probably damaging 1.00
R6856:Ccr6 UTSW 17 8256049 missense probably benign 0.08
R6950:Ccr6 UTSW 17 8257066 makesense probably null
R7102:Ccr6 UTSW 17 8256187 missense probably benign 0.15
R7206:Ccr6 UTSW 17 8256949 missense probably benign
R7223:Ccr6 UTSW 17 8256140 missense probably damaging 1.00
R7323:Ccr6 UTSW 17 8256779 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGCTCCCTAGAAGAGGTCAG -3'
(R):5'- ACAGATGACCTTACTGTGCG -3'

Sequencing Primer
(F):5'- GAAACTTCACCAAGGTATTTGTGCC -3'
(R):5'- TCAGTGTTCTGGAGCGTACCC -3'
Posted On2014-10-02