Incidental Mutation 'R2177:Usp53'
ID236924
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
MMRRC Submission 040179-MU
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2177 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122936057 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 756 (E756G)
Ref Sequence ENSEMBL: ENSMUSP00000087857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379]
Predicted Effect probably damaging
Transcript: ENSMUST00000090379
AA Change: E756G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701
AA Change: E756G

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Ch25h G T 19: 34,474,697 L144M probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Gbf1 T C 19: 46,265,670 S599P probably benign Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Krtap16-1 A G 11: 99,986,449 V43A probably damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Man1a2 A T 3: 100,632,531 I308N probably damaging Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Ulk2 T A 11: 61,791,509 T727S probably benign Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1388:Usp53 UTSW 3 122957628 missense probably damaging 0.96
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3923:Usp53 UTSW 3 122934305 missense probably benign 0.11
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6176:Usp53 UTSW 3 122934003 nonsense probably null
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCTTAGGTCTACATGTTATG -3'
(R):5'- TCAGGTGCAGGATTTTCCC -3'

Sequencing Primer
(F):5'- TTCTGCAAGAGCTCCCA -3'
(R):5'- GGTGCAGGATTTTCCCACTGTAAC -3'
Posted On2014-10-02