Mutagenetix > Incidental Mutation

Incidental Mutation 'R2177:Fxyd4'

236934

Institutional Source

Beutler Lab

Gene Symbol

Fxyd4

Ensembl Gene

ENSMUSG00000004988

Gene Name

FXYD domain-containing ion transport regulator 4

Synonyms

0610008I02Rik, Chif

MMRRC Submission

040179-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117910520-117914653 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 117911393 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 56 (A56T)

Ref Sequence

ENSEMBL: ENSMUSP00000145302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005114] [ENSMUST00000203066] [ENSMUST00000203082] [ENSMUST00000203433] [ENSMUST00000204214] [ENSMUST00000204950]

AlphaFold

Q9D2W0

Predicted Effect

probably damaging
Transcript: ENSMUST00000005114
AA Change: A56T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000005114
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	71	1.4e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175364

Predicted Effect

probably damaging
Transcript: ENSMUST00000203066
AA Change: A56T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000145293
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	71	7.8e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203082
AA Change: A56T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144700
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	71	1.4e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203433
AA Change: A56T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144773
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	60	8.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203921

Predicted Effect

probably damaging
Transcript: ENSMUST00000204214
AA Change: A56T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000145302
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	71	1.4e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204950
AA Change: A56T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145182
Gene: ENSMUSG00000004988
AA Change: A56T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ATP1G1_PLM_MAT8	25	60	8.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205111

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit a significant increase in urine volume (and water intake) under Na⁺ deprivation and K⁺ loading, as well as lethality after a combination of high-K⁺ intake and furosemide injection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	A	5: 88,120,312 (GRCm39)	N356K	probably damaging	Het
Acap2	C	T	16: 30,952,346 (GRCm39)		probably null	Het
Adamts19	T	C	18: 59,087,626 (GRCm39)	L552P	possibly damaging	Het
Adamts2	T	A	11: 50,668,055 (GRCm39)	M539K	probably damaging	Het
Aplp1	A	T	7: 30,141,946 (GRCm39)	C210*	probably null	Het
Apoa1	A	T	9: 46,141,371 (GRCm39)	K156*	probably null	Het
AW551984	G	A	9: 39,511,111 (GRCm39)	R159C	probably benign	Het
Bok	C	T	1: 93,622,787 (GRCm39)	Q112*	probably null	Het
Cemip2	T	C	19: 21,789,149 (GRCm39)	S528P	possibly damaging	Het
Cfap57	T	G	4: 118,463,885 (GRCm39)	I323L	probably benign	Het
Cfap69	T	A	5: 5,675,803 (GRCm39)	E270D	probably damaging	Het
Ch25h	G	T	19: 34,452,097 (GRCm39)	L144M	probably damaging	Het
Clcn6	T	A	4: 148,099,057 (GRCm39)	I429F	possibly damaging	Het
Cpb1	T	A	3: 20,320,611 (GRCm39)	T115S	probably benign	Het
Csf1r	T	A	18: 61,248,015 (GRCm39)		probably benign	Het
Ddx6	A	G	9: 44,539,028 (GRCm39)	T279A	probably damaging	Het
Dnah8	A	G	17: 30,872,367 (GRCm39)	H452R	probably benign	Het
Dscam	T	A	16: 96,411,524 (GRCm39)	D1784V	probably damaging	Het
Exo1	T	A	1: 175,710,456 (GRCm39)		probably null	Het
Fcho1	A	G	8: 72,164,905 (GRCm39)	S459P	probably damaging	Het
Gbf1	T	C	19: 46,254,109 (GRCm39)	S599P	probably benign	Het
Iqce	T	C	5: 140,677,348 (GRCm39)		probably benign	Het
Kat2a	A	G	11: 100,601,648 (GRCm39)	F256L	probably damaging	Het
Klk1b1	G	T	7: 43,618,695 (GRCm39)	R24L	possibly damaging	Het
Krtap16-1	A	G	11: 99,877,275 (GRCm39)	V43A	probably damaging	Het
Maea	C	G	5: 33,529,034 (GRCm39)	Q326E	probably benign	Het
Man1a2	A	T	3: 100,539,847 (GRCm39)	I308N	probably damaging	Het
Marf1	G	T	16: 13,970,471 (GRCm39)	R83S	probably benign	Het
Me3	A	C	7: 89,282,278 (GRCm39)	T54P	probably benign	Het
Mme	A	T	3: 63,208,426 (GRCm39)	I63L	probably benign	Het
Mmel1	A	G	4: 154,978,560 (GRCm39)	N664S	probably damaging	Het
Mrgprb2	A	G	7: 48,202,128 (GRCm39)	V199A	probably benign	Het
Mrpl36	T	A	13: 73,479,588 (GRCm39)	F33I	probably benign	Het
Nlrp4e	A	T	7: 23,054,686 (GRCm39)	T947S	probably benign	Het
Or14c45	G	A	7: 86,176,870 (GRCm39)	V302I	probably benign	Het
Or4b1d	T	A	2: 89,968,808 (GRCm39)	H225L	possibly damaging	Het
Or8b55	A	T	9: 38,727,482 (GRCm39)	I228F	possibly damaging	Het
Parp4	A	T	14: 56,896,746 (GRCm39)	R1923S	unknown	Het
Pcm1	T	C	8: 41,729,002 (GRCm39)	V658A	probably benign	Het
Pkhd1l1	A	G	15: 44,322,791 (GRCm39)	S26G	probably benign	Het
Prom1	A	T	5: 44,184,081 (GRCm39)	H433Q	possibly damaging	Het
Rab7	T	C	6: 87,982,063 (GRCm39)	D104G	probably damaging	Het
Rabgap1l	A	G	1: 160,551,632 (GRCm39)	V282A	possibly damaging	Het
Rdh13	T	C	7: 4,430,666 (GRCm39)	E264G	possibly damaging	Het
Rock1	C	G	18: 10,070,263 (GRCm39)	R1270T	probably benign	Het
Sdhaf4	C	T	1: 24,035,370 (GRCm39)	G93R	probably damaging	Het
Sec24a	T	C	11: 51,595,228 (GRCm39)	T910A	probably benign	Het
Sesn1	A	G	10: 41,779,778 (GRCm39)	H345R	possibly damaging	Het
Snx4	T	A	16: 33,106,428 (GRCm39)		probably null	Het
Tchh	A	G	3: 93,351,439 (GRCm39)	E293G	unknown	Het
Ulk2	T	A	11: 61,682,335 (GRCm39)	T727S	probably benign	Het
Usp53	T	C	3: 122,729,706 (GRCm39)	E756G	probably damaging	Het
Vmn2r68	G	A	7: 84,871,123 (GRCm39)	A720V	probably benign	Het
Vmn2r79	A	G	7: 86,645,839 (GRCm39)	N56S	possibly damaging	Het
Washc5	A	T	15: 59,235,118 (GRCm39)	Y263*	probably null	Het
Zfp119b	A	T	17: 56,245,639 (GRCm39)	C516S	probably damaging	Het

Other mutations in Fxyd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R5921:Fxyd4	UTSW	6	117,913,099 (GRCm39)	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTTGCCCAATGAATAGTCAGGG -3'
(R):5'- TTGTAAAGACGTCCCACAAAGC -3'

Sequencing Primer
(F):5'- GGTCCTAGAACTTTATCCCCGTAAAG -3'
(R):5'- GTCCCACAAAGCCACACTC -3'

Posted On

2014-10-02