Incidental Mutation 'R2177:Ulk2'
ID236955
Institutional Source Beutler Lab
Gene Symbol Ulk2
Ensembl Gene ENSMUSG00000004798
Gene Nameunc-51 like kinase 2
SynonymsUnc51.2, A830085I22Rik
MMRRC Submission 040179-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R2177 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61775649-61855073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61791509 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 727 (T727S)
Ref Sequence ENSEMBL: ENSMUSP00000004920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004920]
Predicted Effect probably benign
Transcript: ENSMUST00000004920
AA Change: T727S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798
AA Change: T727S

DomainStartEndE-ValueType
S_TKc 9 271 1.1e-93 SMART
low complexity region 274 309 N/A INTRINSIC
Blast:S_TKc 310 413 9e-28 BLAST
Blast:S_TKc 433 738 1e-29 BLAST
low complexity region 751 766 N/A INTRINSIC
low complexity region 771 791 N/A INTRINSIC
Pfam:DUF3543 821 1032 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129025
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Ch25h G T 19: 34,474,697 L144M probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Gbf1 T C 19: 46,265,670 S599P probably benign Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Krtap16-1 A G 11: 99,986,449 V43A probably damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Man1a2 A T 3: 100,632,531 I308N probably damaging Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Usp53 T C 3: 122,936,057 E756G probably damaging Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Ulk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ulk2 APN 11 61791436 nonsense probably null
IGL02044:Ulk2 APN 11 61781639 missense probably damaging 1.00
IGL02185:Ulk2 APN 11 61782060 missense probably damaging 1.00
IGL03036:Ulk2 APN 11 61834834 missense probably damaging 1.00
R0207:Ulk2 UTSW 11 61777785 missense probably benign 0.42
R0362:Ulk2 UTSW 11 61787586 missense probably benign
R0657:Ulk2 UTSW 11 61808054 splice site probably benign
R1076:Ulk2 UTSW 11 61819309 missense probably damaging 1.00
R1144:Ulk2 UTSW 11 61800060 missense possibly damaging 0.80
R1573:Ulk2 UTSW 11 61779755 missense probably damaging 1.00
R1583:Ulk2 UTSW 11 61783545 missense possibly damaging 0.95
R1619:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R1757:Ulk2 UTSW 11 61841339 splice site probably benign
R1845:Ulk2 UTSW 11 61812738 missense probably benign 0.04
R1883:Ulk2 UTSW 11 61830612 missense probably damaging 1.00
R1966:Ulk2 UTSW 11 61819471 splice site probably null
R2416:Ulk2 UTSW 11 61782039 missense probably damaging 1.00
R2509:Ulk2 UTSW 11 61787514 missense probably benign 0.00
R2847:Ulk2 UTSW 11 61824729 critical splice acceptor site probably null
R4736:Ulk2 UTSW 11 61833435 missense probably damaging 1.00
R4997:Ulk2 UTSW 11 61799156 missense probably benign 0.00
R5081:Ulk2 UTSW 11 61803662 missense probably damaging 1.00
R5190:Ulk2 UTSW 11 61781711 missense probably benign
R5346:Ulk2 UTSW 11 61834914 missense probably damaging 1.00
R5348:Ulk2 UTSW 11 61783613 missense probably benign
R5520:Ulk2 UTSW 11 61808144 missense probably damaging 1.00
R5954:Ulk2 UTSW 11 61803796 splice site probably benign
R6153:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R6223:Ulk2 UTSW 11 61787504 nonsense probably null
X0028:Ulk2 UTSW 11 61799568 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTACAGGGACAGAAAGCAAAG -3'
(R):5'- AAACATTGAATACTGGGCTTCTTT -3'

Sequencing Primer
(F):5'- GGCAAGAGAAGTGAGGGGATTTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2014-10-02