Mutagenetix > Incidental Mutation

Incidental Mutation 'R2178:Vmn2r68'

237000

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

EG620697, Vmn2r68-ps

MMRRC Submission

040180-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R2178 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

84870726-84886912 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

TCC to TC at 84870758 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably null
Transcript: ENSMUST00000061074

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	A	T	15: 98,492,236 (GRCm39)	N1007K	probably damaging	Het
Apon	C	A	10: 128,090,634 (GRCm39)	A104E	probably benign	Het
Cdh15	T	A	8: 123,591,715 (GRCm39)		probably null	Het
Cep135	T	C	5: 76,779,297 (GRCm39)	V769A	probably benign	Het
Cep152	A	T	2: 125,421,954 (GRCm39)		probably null	Het
Clca3a1	T	C	3: 144,711,863 (GRCm39)	N711D	probably damaging	Het
Col1a2	T	C	6: 4,531,143 (GRCm39)	F731L	unknown	Het
Cpt1b	T	C	15: 89,303,246 (GRCm39)	E603G	probably damaging	Het
Cspp1	T	G	1: 10,174,471 (GRCm39)	D641E	possibly damaging	Het
Ddr2	C	T	1: 169,822,251 (GRCm39)	R399Q	probably benign	Het
Dzip1	T	C	14: 119,126,816 (GRCm39)		probably null	Het
Greb1	A	G	12: 16,746,388 (GRCm39)	V1294A	probably damaging	Het
Hmgb4	A	G	4: 128,154,275 (GRCm39)	S98P	probably damaging	Het
Kif12	G	A	4: 63,085,196 (GRCm39)	P515L	probably benign	Het
Kmt5b	A	C	19: 3,865,372 (GRCm39)	E789A	possibly damaging	Het
Lama1	G	T	17: 68,076,510 (GRCm39)	V1095F	probably benign	Het
Leprot	T	C	4: 101,513,308 (GRCm39)	V32A	probably benign	Het
Mcoln1	A	G	8: 3,558,766 (GRCm39)	T255A	probably damaging	Het
Mertk	G	A	2: 128,634,984 (GRCm39)	E765K	probably damaging	Het
Muc5b	A	G	7: 141,417,853 (GRCm39)	T3600A	possibly damaging	Het
Ncapd3	A	T	9: 26,999,845 (GRCm39)	E1395V	probably benign	Het
Ntrk2	T	C	13: 58,956,616 (GRCm39)	F25S	probably benign	Het
Or2a5	A	G	6: 42,873,732 (GRCm39)	M116V	probably benign	Het
Or6z1	G	T	7: 6,504,487 (GRCm39)	A246D	probably damaging	Het
Or7c70	T	A	10: 78,683,612 (GRCm39)	I46F	probably damaging	Het
Pappa	C	A	4: 65,269,924 (GRCm39)	H1613N	probably benign	Het
Polq	T	C	16: 36,883,191 (GRCm39)	V1785A	probably damaging	Het
Pramel23	A	T	4: 143,424,612 (GRCm39)	I277K	possibly damaging	Het
Prkar2a	T	C	9: 108,617,737 (GRCm39)		probably null	Het
Qrich2	T	C	11: 116,334,603 (GRCm39)	D2194G	probably damaging	Het
Rnf183	T	C	4: 62,346,333 (GRCm39)	N155S	probably benign	Het
S1pr5	T	C	9: 21,155,760 (GRCm39)	N222S	probably benign	Het
Scnn1a	C	T	6: 125,307,965 (GRCm39)	R170C	probably damaging	Het
Slc25a2	T	C	18: 37,771,311 (GRCm39)	T73A	probably benign	Het
Tgfb1	A	G	7: 25,404,234 (GRCm39)	N347S	probably damaging	Het
Ticrr	T	C	7: 79,315,433 (GRCm39)	V229A	probably benign	Het
Tjp3	T	C	10: 81,115,941 (GRCm39)	E313G	probably benign	Het
Tnfsf11	A	G	14: 78,521,682 (GRCm39)	S176P	probably benign	Het
Vps39	C	A	2: 120,154,160 (GRCm39)	E612*	probably null	Het
Vwf	T	A	6: 125,619,095 (GRCm39)	Y1258N	possibly damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	84,886,819 (GRCm39)	missense	probably benign
IGL01477:Vmn2r68	APN	7	84,882,691 (GRCm39)	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	84,871,468 (GRCm39)	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	84,871,325 (GRCm39)	missense	probably benign
IGL01999:Vmn2r68	APN	7	84,871,439 (GRCm39)	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	84,870,947 (GRCm39)	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	84,871,153 (GRCm39)	nonsense	probably null
IGL02827:Vmn2r68	APN	7	84,886,800 (GRCm39)	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	84,882,595 (GRCm39)	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	84,883,649 (GRCm39)	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	84,871,448 (GRCm39)	nonsense	probably null
IGL03166:Vmn2r68	APN	7	84,871,331 (GRCm39)	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	84,870,972 (GRCm39)	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	84,882,963 (GRCm39)	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	84,871,088 (GRCm39)	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0280:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0281:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0348:Vmn2r68	UTSW	7	84,870,884 (GRCm39)	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	84,882,466 (GRCm39)	critical splice donor site	probably null
R0390:Vmn2r68	UTSW	7	84,882,457 (GRCm39)	splice site	probably benign
R0722:Vmn2r68	UTSW	7	84,870,794 (GRCm39)	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	84,886,712 (GRCm39)	splice site	probably null
R1136:Vmn2r68	UTSW	7	84,871,549 (GRCm39)	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	84,881,700 (GRCm39)	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	84,870,946 (GRCm39)	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	84,882,574 (GRCm39)	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	84,882,886 (GRCm39)	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	84,883,867 (GRCm39)	nonsense	probably null
R1908:Vmn2r68	UTSW	7	84,883,260 (GRCm39)	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	84,883,260 (GRCm39)	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	84,883,102 (GRCm39)	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	84,871,123 (GRCm39)	missense	probably benign	0.01
R2185:Vmn2r68	UTSW	7	84,882,901 (GRCm39)	nonsense	probably null
R2188:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R2282:Vmn2r68	UTSW	7	84,870,859 (GRCm39)	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	84,883,803 (GRCm39)	missense	probably benign
R2869:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	84,882,834 (GRCm39)	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	84,886,875 (GRCm39)	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R3978:Vmn2r68	UTSW	7	84,881,670 (GRCm39)	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4401:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4421:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4478:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4479:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4495:Vmn2r68	UTSW	7	84,870,758 (GRCm39)	frame shift	probably null
R4628:Vmn2r68	UTSW	7	84,883,673 (GRCm39)	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	84,870,743 (GRCm39)	missense	probably benign
R4654:Vmn2r68	UTSW	7	84,882,769 (GRCm39)	nonsense	probably null
R4793:Vmn2r68	UTSW	7	84,883,648 (GRCm39)	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	84,881,622 (GRCm39)	missense	probably benign
R5021:Vmn2r68	UTSW	7	84,882,942 (GRCm39)	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	84,883,076 (GRCm39)	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	84,871,199 (GRCm39)	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	84,871,085 (GRCm39)	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	84,886,767 (GRCm39)	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	84,882,926 (GRCm39)	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	84,871,283 (GRCm39)	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	84,882,978 (GRCm39)	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	84,886,812 (GRCm39)	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	84,871,453 (GRCm39)	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	84,883,048 (GRCm39)	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	84,870,973 (GRCm39)	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	84,882,915 (GRCm39)	missense	probably benign
R6699:Vmn2r68	UTSW	7	84,881,583 (GRCm39)	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	84,871,460 (GRCm39)	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	84,883,042 (GRCm39)	missense	probably benign
R7374:Vmn2r68	UTSW	7	84,881,607 (GRCm39)	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	84,881,587 (GRCm39)	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	84,883,116 (GRCm39)	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	84,883,722 (GRCm39)	missense	probably benign
R7979:Vmn2r68	UTSW	7	84,883,625 (GRCm39)	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	84,871,422 (GRCm39)	nonsense	probably null
R8349:Vmn2r68	UTSW	7	84,882,785 (GRCm39)	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	84,871,108 (GRCm39)	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	84,886,722 (GRCm39)	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	84,882,785 (GRCm39)	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	84,883,648 (GRCm39)	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	84,871,321 (GRCm39)	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	84,871,420 (GRCm39)	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	84,882,993 (GRCm39)	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	84,882,757 (GRCm39)	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	84,871,088 (GRCm39)	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	84,871,289 (GRCm39)	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	84,870,941 (GRCm39)	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	84,871,307 (GRCm39)	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CATGTCTGTACTATCAACATGGC -3'
(R):5'- AGTGTCTGGATTACTTTCATCCCTG -3'

Sequencing Primer
(F):5'- GTTTATTCAACAAACTGTGGTACAGG -3'
(R):5'- TGTCTACCACAGCACCAAAGG -3'

Posted On

2014-10-02