Incidental Mutation 'R2181:Gbp7'
ID237174
Institutional Source Beutler Lab
Gene Symbol Gbp7
Ensembl Gene ENSMUSG00000040253
Gene Nameguanylate binding protein 7
Synonyms9830147J24Rik
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142530342-142550149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142544030 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 421 (I421V)
Ref Sequence ENSEMBL: ENSMUSP00000132970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045097] [ENSMUST00000171263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045097
AA Change: I421V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049104
Gene: ENSMUSG00000040253
AA Change: I421V

DomainStartEndE-ValueType
Pfam:GBP 18 281 6.6e-128 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171263
AA Change: I421V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132970
Gene: ENSMUSG00000040253
AA Change: I421V

DomainStartEndE-ValueType
Pfam:GBP 18 281 1e-126 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197826
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Gbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gbp7 APN 3 142546428 missense probably benign 0.01
IGL01020:Gbp7 APN 3 142542857 missense probably benign 0.03
IGL01959:Gbp7 APN 3 142541347 splice site probably benign
IGL02002:Gbp7 APN 3 142538900 missense probably damaging 1.00
IGL02008:Gbp7 APN 3 142546450 missense probably benign 0.11
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0398:Gbp7 UTSW 3 142545513 missense possibly damaging 0.93
R0486:Gbp7 UTSW 3 142546317 splice site probably benign
R0645:Gbp7 UTSW 3 142538165 intron probably null
R0961:Gbp7 UTSW 3 142541557 nonsense probably null
R1834:Gbp7 UTSW 3 142534680 missense probably damaging 1.00
R2089:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2089:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2091:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2921:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R2922:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R3819:Gbp7 UTSW 3 142544065 missense possibly damaging 0.81
R4747:Gbp7 UTSW 3 142543017 missense probably damaging 1.00
R4748:Gbp7 UTSW 3 142538087 missense probably benign 0.00
R5899:Gbp7 UTSW 3 142546542 missense probably benign
R6082:Gbp7 UTSW 3 142545936 missense probably benign 0.01
R6211:Gbp7 UTSW 3 142545993 missense probably benign 0.12
R6330:Gbp7 UTSW 3 142546498 missense probably benign
R6419:Gbp7 UTSW 3 142546453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGACTCTGTGGGACTG -3'
(R):5'- TTCTAAGGAGGAGCGAGACTC -3'

Sequencing Primer
(F):5'- ACTCTGTGGGACTGAAGAGAATTTTC -3'
(R):5'- AGCGAGACTCCTGGCAAC -3'
Posted On2014-10-02