Incidental Mutation 'R2181:Penk'
ID237175
Institutional Source Beutler Lab
Gene Symbol Penk
Ensembl Gene ENSMUSG00000045573
Gene Namepreproenkephalin
SynonymsENK, Penk, Penk1, PPA
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location4133531-4138819 bp(-) (GRCm38)
Type of Mutationunclassified (71 bp from exon)
DNA Base Change (assembly) T to C at 4134041 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070375] [ENSMUST00000133567]
Predicted Effect probably benign
Transcript: ENSMUST00000070375
AA Change: D202G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000066822
Gene: ENSMUSG00000045573
AA Change: D202G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 70 1.5e-19 PFAM
internal_repeat_1 90 141 4.19e-10 PROSPERO
internal_repeat_1 201 267 4.19e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131498
Predicted Effect probably null
Transcript: ENSMUST00000133567
SMART Domains Protein: ENSMUSP00000122389
Gene: ENSMUSG00000045573

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 72 3.2e-23 PFAM
Blast:CYCc 108 176 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit nitrituria. Female homozygotes display decreased circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Penk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Penk APN 4 4134347 missense probably damaging 1.00
IGL01901:Penk APN 4 4134465 missense probably benign 0.02
IGL02634:Penk APN 4 4134065 missense possibly damaging 0.92
IGL02935:Penk APN 4 4133843 missense probably damaging 0.99
R0712:Penk UTSW 4 4134257 missense probably benign 0.35
R1126:Penk UTSW 4 4138119 missense probably benign 0.00
R1331:Penk UTSW 4 4134287 missense probably benign 0.02
R1720:Penk UTSW 4 4134240 missense probably damaging 1.00
R3154:Penk UTSW 4 4134152 missense probably damaging 0.96
R5184:Penk UTSW 4 4134296 missense probably damaging 1.00
R5779:Penk UTSW 4 4134318 missense probably damaging 1.00
R5939:Penk UTSW 4 4138010 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTCAGAACCGCATAAAG -3'
(R):5'- AGGTATGGCGGCTTCATGAAG -3'

Sequencing Primer
(F):5'- GCATAAAGCCCCCGTATCTTTTC -3'
(R):5'- TTCATGAAGAAGGATGCAGATGAG -3'
Posted On2014-10-02