Incidental Mutation 'R0173:Gab1'
ID23718
Institutional Source Beutler Lab
Gene Symbol Gab1
Ensembl Gene ENSMUSG00000031714
Gene Namegrowth factor receptor bound protein 2-associated protein 1
Synonyms
MMRRC Submission 038445-MU
Accession Numbers

Genbank: NM_021356; MGI: 108088

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location80764438-80880519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80800160 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000147784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]
Predicted Effect probably benign
Transcript: ENSMUST00000034150
AA Change: D103G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: D103G

DomainStartEndE-ValueType
PH 6 118 1.16e-23 SMART
low complexity region 336 354 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210676
AA Change: D103G

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211018
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Gab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01679:Gab1 APN 8 80791549 missense probably benign 0.00
IGL02610:Gab1 APN 8 80800099 critical splice donor site probably null
IGL02661:Gab1 APN 8 80788937 missense probably damaging 1.00
IGL02716:Gab1 APN 8 80769694 missense probably damaging 1.00
D3080:Gab1 UTSW 8 80766378 missense probably damaging 1.00
R0006:Gab1 UTSW 8 80769730 missense possibly damaging 0.56
R0144:Gab1 UTSW 8 80785201 splice site probably benign
R0414:Gab1 UTSW 8 80800289 missense probably damaging 1.00
R0503:Gab1 UTSW 8 80800142 missense probably damaging 1.00
R0675:Gab1 UTSW 8 80769668 missense probably damaging 1.00
R0690:Gab1 UTSW 8 80800116 missense probably damaging 1.00
R1068:Gab1 UTSW 8 80800172 missense possibly damaging 0.95
R1175:Gab1 UTSW 8 80784842 missense probably damaging 0.99
R1240:Gab1 UTSW 8 80788530 missense probably damaging 1.00
R1430:Gab1 UTSW 8 80788612 missense probably benign 0.34
R1656:Gab1 UTSW 8 80788759 missense probably damaging 1.00
R1986:Gab1 UTSW 8 80766381 missense probably damaging 1.00
R2860:Gab1 UTSW 8 80784753 missense probably benign 0.32
R2861:Gab1 UTSW 8 80784753 missense probably benign 0.32
R4683:Gab1 UTSW 8 80788632 missense probably benign 0.34
R4726:Gab1 UTSW 8 80789053 missense possibly damaging 0.80
R5425:Gab1 UTSW 8 80800389 missense probably damaging 1.00
R5684:Gab1 UTSW 8 80769670 missense probably damaging 1.00
R6195:Gab1 UTSW 8 80879532 nonsense probably null
R6217:Gab1 UTSW 8 80791608 missense possibly damaging 0.48
R6233:Gab1 UTSW 8 80879532 nonsense probably null
R6407:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6408:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6415:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6418:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6479:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R7019:Gab1 UTSW 8 80784817 missense probably damaging 0.99
R7291:Gab1 UTSW 8 80800151 missense probably damaging 1.00
R7432:Gab1 UTSW 8 80788669 missense probably benign 0.20
X0066:Gab1 UTSW 8 80879564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGCTCAAAATGTCAAATTCCG -3'
(R):5'- ACGATCATGCCAAGAAGCCTATTCG -3'

Sequencing Primer
(F):5'- agaacatctgtaacttcagtccc -3'
(R):5'- GCAAGTTGATGCTGGGTTGA -3'
Posted On2013-04-16