Incidental Mutation 'R2181:Zfp804b'
ID237180
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6771674 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 463 (T463I)
Ref Sequence ENSEMBL: ENSMUSP00000143568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably damaging
Transcript: ENSMUST00000164784
AA Change: T427I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: T427I

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200317
AA Change: T463I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: T463I

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTAGCTACACTCATCTTTGGTTTCAG -3'
(R):5'- GAGGCCAGAGCAAAGTCTTC -3'

Sequencing Primer
(F):5'- CACTCATCTTTGGTTTCAGAGATTG -3'
(R):5'- GCCAGAGCAAAGTCTTCAGATGAATC -3'
Posted On2014-10-02