Incidental Mutation 'R2181:Vmn1r72'
ID237184
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Namevomeronasal 1 receptor 72
SynonymsV1rg1
MMRRC Submission 040183-MU
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location11664479-11680147 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 11669668 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 284 (C284*)
Ref Sequence ENSEMBL: ENSMUSP00000154511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053134] [ENSMUST00000209638] [ENSMUST00000227010]
Predicted Effect probably null
Transcript: ENSMUST00000053134
AA Change: C284*
SMART Domains Protein: ENSMUSP00000052997
Gene: ENSMUSG00000095430
AA Change: C284*

DomainStartEndE-ValueType
Pfam:TAS2R 1 305 1.8e-9 PFAM
Pfam:V1R 25 300 6.7e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209638
AA Change: C284*
Predicted Effect probably null
Transcript: ENSMUST00000227010
AA Change: C284*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
IGL03014:Vmn1r72 UTSW 7 11669784 missense possibly damaging 0.80
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R0524:Vmn1r72 UTSW 7 11669792 missense probably benign 0.32
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5700:Vmn1r72 UTSW 7 11670423 missense probably damaging 0.98
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R6439:Vmn1r72 UTSW 7 11679137 intron probably null
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGACTGACACTGGTGTAGAGTC -3'
(R):5'- GGCTCAGTACTTTCTAAAACAATCACC -3'

Sequencing Primer
(F):5'- GGAGTACAATGCCCTCTTAAAGACTG -3'
(R):5'- TTTCTAAAACAATCACCAGAAAACAG -3'
Posted On2014-10-02