Incidental Mutation 'R2181:Numbl'
ID237185
Institutional Source Beutler Lab
Gene Symbol Numbl
Ensembl Gene ENSMUSG00000063160
Gene Namenumb-like
Synonymsnbl
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2181 (G1)
Quality Score184
Status Not validated
Chromosome7
Chromosomal Location27258433-27282144 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 27268921 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079258]
Predicted Effect probably null
Transcript: ENSMUST00000079258
SMART Domains Protein: ENSMUSP00000078245
Gene: ENSMUSG00000063160

DomainStartEndE-ValueType
PTB 75 205 1.11e-38 SMART
low complexity region 234 260 N/A INTRINSIC
Pfam:NumbF 287 371 3.5e-32 PFAM
coiled coil region 417 444 N/A INTRINSIC
low complexity region 532 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149805
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypes except for a reduction in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Numbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Numbl APN 7 27268810 missense possibly damaging 0.50
IGL01389:Numbl APN 7 27281047 missense possibly damaging 0.94
IGL02671:Numbl APN 7 27264902 missense probably damaging 1.00
F5770:Numbl UTSW 7 27279602 missense probably benign
R0212:Numbl UTSW 7 27280759 missense probably damaging 1.00
R0709:Numbl UTSW 7 27273990 missense probably damaging 1.00
R1768:Numbl UTSW 7 27280954 missense probably benign
R5071:Numbl UTSW 7 27280990 missense probably damaging 1.00
R5072:Numbl UTSW 7 27280990 missense probably damaging 1.00
R5074:Numbl UTSW 7 27280990 missense probably damaging 1.00
R6134:Numbl UTSW 7 27281314 missense probably damaging 0.98
R6387:Numbl UTSW 7 27276690 missense probably damaging 0.99
R6989:Numbl UTSW 7 27280840 missense probably damaging 1.00
V7580:Numbl UTSW 7 27279602 missense probably benign
V7583:Numbl UTSW 7 27279602 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTTGACTGCAGGCAAGAG -3'
(R):5'- ACAGACACTCCCTTCTTGAGATG -3'

Sequencing Primer
(F):5'- CAAGAGAGATGGTTTTTCACTGCC -3'
(R):5'- CTGGCTGCCTTCAGATCAAGATG -3'
Posted On2014-10-02