Incidental Mutation 'R2181:Vmn2r76'
ID237187
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86225535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 745 (I745V)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: I745V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: I745V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCCTTTCCATTGGTGC -3'
(R):5'- ACAATTACTGTAGTACTGGCCTTCAG -3'

Sequencing Primer
(F):5'- CCATTGGTGCTATGATAGACAGG -3'
(R):5'- CAGGTTCACTCTTCCTAGTAAAAGG -3'
Posted On2014-10-02