Incidental Mutation 'R2181:Gorasp1'
ID237192
Institutional Source Beutler Lab
Gene Symbol Gorasp1
Ensembl Gene ENSMUSG00000032513
Gene Namegolgi reassembly stacking protein 1
SynonymsGRASP65, GOLPH5, P65, 5430411C10Rik
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R2181 (G1)
Quality Score190
Status Not validated
Chromosome9
Chromosomal Location119925257-119937565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119928356 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 317 (S317P)
Ref Sequence ENSEMBL: ENSMUSP00000035099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035099] [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307]
Predicted Effect probably damaging
Transcript: ENSMUST00000035099
AA Change: S317P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035099
Gene: ENSMUSG00000032513
AA Change: S317P

DomainStartEndE-ValueType
Pfam:GRASP55_65 2 99 2.6e-22 PFAM
Pfam:GRASP55_65 68 204 4e-60 PFAM
low complexity region 212 224 N/A INTRINSIC
low complexity region 329 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036561
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214118
Predicted Effect probably benign
Transcript: ENSMUST00000215167
Predicted Effect probably benign
Transcript: ENSMUST00000215307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217429
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a membrane protein involved in establishing the stacked structure of the Golgi apparatus. It is a caspase-3 substrate, and cleavage of this encoded protein contributes to Golgi fragmentation in apoptosis. This encoded protein can form a complex with the Golgi matrix protein GOLGA2, and this complex binds to the vesicle docking protein p115. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable, fertile and healthy with no detectable tissue defects. However, immortalized mutant embryonic fibroblasts show loss of cis Golgi integrity and glycosylation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Gorasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Gorasp1 UTSW 9 119928246 missense possibly damaging 0.91
R1782:Gorasp1 UTSW 9 119932822 missense probably damaging 1.00
R1873:Gorasp1 UTSW 9 119930240 missense probably benign 0.23
R4020:Gorasp1 UTSW 9 119928870 missense probably benign 0.00
R5356:Gorasp1 UTSW 9 119927958 missense probably damaging 1.00
R6059:Gorasp1 UTSW 9 119930006 missense probably damaging 0.99
R6525:Gorasp1 UTSW 9 119927995 missense possibly damaging 0.78
R6798:Gorasp1 UTSW 9 119929597 missense probably benign 0.02
X0021:Gorasp1 UTSW 9 119929971 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACAGGATTTCTCAGACGGC -3'
(R):5'- CATGATGTTCAGCTCTGGGTTC -3'

Sequencing Primer
(F):5'- GGATTTCTCAGACGGCATCAC -3'
(R):5'- GCTCCCATATCTCCAGTAGT -3'
Posted On2014-10-02