Incidental Mutation 'R2181:Pld2'
ID237196
Institutional Source Beutler Lab
Gene Symbol Pld2
Ensembl Gene ENSMUSG00000020828
Gene Namephospholipase D2
Synonyms
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70540064-70558110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70542989 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000104196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018429] [ENSMUST00000108556] [ENSMUST00000108557] [ENSMUST00000157075]
Predicted Effect probably benign
Transcript: ENSMUST00000018429
AA Change: T252A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000018429
Gene: ENSMUSG00000020828
AA Change: T252A

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 751 778 4.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100943
Predicted Effect possibly damaging
Transcript: ENSMUST00000108556
AA Change: T252A

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104196
Gene: ENSMUSG00000020828
AA Change: T252A

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108557
AA Change: T252A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104197
Gene: ENSMUSG00000020828
AA Change: T252A

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 762 789 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157075
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the phospholipase D (PLD) superfamily. The encoded protein catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. Phosphatidic acid is an essential intracellular lipid second messenger for many signaling pathways and has been implicated in a variety of physiological processes including cytoskeletal organization and cell proliferation. A similar gene in human may also function as a guanine nucleotide exchange factor (GEF) for the small GTPase Rac2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out fail to exhibit Abeta42 suppression of LTP and show altered brain phosphatidic acid levels. Mice homozygous for a different knock-out allele show normal platelet function, hemostasis and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Pld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Pld2 APN 11 70551180 nonsense probably null
IGL01094:Pld2 APN 11 70541306 missense probably damaging 0.99
IGL01696:Pld2 APN 11 70542780 missense probably damaging 1.00
IGL02165:Pld2 APN 11 70555677 missense probably damaging 1.00
IGL02477:Pld2 APN 11 70540925 missense possibly damaging 0.60
IGL02712:Pld2 APN 11 70557079 missense probably benign 0.44
IGL03013:Pld2 APN 11 70541177 missense probably damaging 1.00
R0117:Pld2 UTSW 11 70557388 missense probably benign 0.19
R0130:Pld2 UTSW 11 70554348 missense probably benign
R0508:Pld2 UTSW 11 70552542 missense probably damaging 0.98
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0974:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R1907:Pld2 UTSW 11 70544184 missense probably damaging 0.99
R2087:Pld2 UTSW 11 70542960 missense probably damaging 1.00
R2379:Pld2 UTSW 11 70554314 missense probably benign 0.01
R3772:Pld2 UTSW 11 70544123 unclassified probably benign
R3949:Pld2 UTSW 11 70553354 missense probably benign
R4028:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4029:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4160:Pld2 UTSW 11 70541427 missense probably damaging 1.00
R4428:Pld2 UTSW 11 70541334 missense probably damaging 1.00
R4595:Pld2 UTSW 11 70542020 missense probably damaging 1.00
R4945:Pld2 UTSW 11 70555698 missense probably damaging 1.00
R5280:Pld2 UTSW 11 70552759 missense probably damaging 1.00
R5659:Pld2 UTSW 11 70557561 makesense probably null
R5773:Pld2 UTSW 11 70555932 missense probably damaging 1.00
R5900:Pld2 UTSW 11 70556062 critical splice donor site probably null
R6249:Pld2 UTSW 11 70555370 missense probably damaging 1.00
R6362:Pld2 UTSW 11 70554675 missense probably damaging 1.00
R6746:Pld2 UTSW 11 70541107 missense probably damaging 0.96
R6922:Pld2 UTSW 11 70553447 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGCCGAGACCAAGTTTGTTATC -3'
(R):5'- TTACTCAAAGCTCTGGCCGG -3'

Sequencing Primer
(F):5'- CCAAGTTTGTTATCGATGGTCCAAG -3'
(R):5'- AGGATTGAAGAGCCTCCCTTTTC -3'
Posted On2014-10-02