Incidental Mutation 'R2181:Mmp28'
ID237197
Institutional Source Beutler Lab
Gene Symbol Mmp28
Ensembl Gene ENSMUSG00000020682
Gene Namematrix metallopeptidase 28 (epilysin)
Synonymsepilysin
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83440768-83463071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83442717 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 466 (V466G)
Ref Sequence ENSEMBL: ENSMUSP00000103772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021020] [ENSMUST00000037378] [ENSMUST00000103209] [ENSMUST00000108137] [ENSMUST00000119346] [ENSMUST00000188702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021020
AA Change: V456G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682
AA Change: V456G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037378
SMART Domains Protein: ENSMUSP00000042098
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 5 169 1.3e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103209
AA Change: V442G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099498
Gene: ENSMUSG00000020682
AA Change: V442G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 9.7e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 349 392 1.64e-1 SMART
HX 394 440 1.78e-2 SMART
HX 442 486 5.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108137
AA Change: V466G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103772
Gene: ENSMUSG00000020682
AA Change: V466G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 2.6e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
HX 373 416 1.64e-1 SMART
HX 418 464 1.78e-2 SMART
HX 466 510 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119346
SMART Domains Protein: ENSMUSP00000112566
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 7.4e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188702
SMART Domains Protein: ENSMUSP00000140664
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 6 111 2.8e-48 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Null homozygote mice have enhanced chemotaxis of macrophages into the lung upon infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Mmp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp28 APN 11 83443776 missense possibly damaging 0.93
IGL02559:Mmp28 APN 11 83447740 missense probably benign 0.00
R0399:Mmp28 UTSW 11 83451732 missense probably damaging 1.00
R0492:Mmp28 UTSW 11 83443803 missense probably damaging 1.00
R1432:Mmp28 UTSW 11 83442939 missense probably damaging 1.00
R1822:Mmp28 UTSW 11 83444219 missense probably damaging 0.99
R5346:Mmp28 UTSW 11 83442663 missense probably benign
R5532:Mmp28 UTSW 11 83442858 missense probably damaging 1.00
R5548:Mmp28 UTSW 11 83443907 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGGGAGCCTTCAGAACAG -3'
(R):5'- CACAGGGAATCGTTGTTGGAGG -3'

Sequencing Primer
(F):5'- GAGCCTTCAGAACAGGGCAC -3'
(R):5'- AGGTTCCAGGGCACGAAGTC -3'
Posted On2014-10-02