Incidental Mutation 'R2181:Ppp2r5e'
ID237198
Institutional Source Beutler Lab
Gene Symbol Ppp2r5e
Ensembl Gene ENSMUSG00000021051
Gene Nameprotein phosphatase 2, regulatory subunit B', epsilon
SynonymsB56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location75450881-75596245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75462324 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 394 (I394V)
Ref Sequence ENSEMBL: ENSMUSP00000021447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021447] [ENSMUST00000218012] [ENSMUST00000220035]
Predicted Effect probably benign
Transcript: ENSMUST00000021447
AA Change: I394V

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021447
Gene: ENSMUSG00000021051
AA Change: I394V

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
Pfam:B56 48 453 3.2e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218012
Predicted Effect probably benign
Transcript: ENSMUST00000220035
AA Change: I360V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Ppp2r5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02602:Ppp2r5e APN 12 75493439 missense probably damaging 1.00
IGL03398:Ppp2r5e APN 12 75462405 missense possibly damaging 0.73
IGL03402:Ppp2r5e APN 12 75464893 missense probably damaging 0.99
R0129:Ppp2r5e UTSW 12 75462390 missense probably damaging 1.00
R0466:Ppp2r5e UTSW 12 75462442 splice site probably benign
R0894:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1452:Ppp2r5e UTSW 12 75469536 splice site probably benign
R1551:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1614:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1693:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1844:Ppp2r5e UTSW 12 75469766 missense possibly damaging 0.81
R1864:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1908:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1909:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1933:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R3084:Ppp2r5e UTSW 12 75468616 missense probably benign 0.23
R4212:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4213:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4680:Ppp2r5e UTSW 12 75469759 missense probably damaging 1.00
R4761:Ppp2r5e UTSW 12 75593261 missense possibly damaging 0.92
R5147:Ppp2r5e UTSW 12 75469770 missense probably damaging 0.96
R5262:Ppp2r5e UTSW 12 75593271 missense probably damaging 1.00
R5304:Ppp2r5e UTSW 12 75515685 missense possibly damaging 0.75
R5429:Ppp2r5e UTSW 12 75453763 missense probably damaging 0.99
R5439:Ppp2r5e UTSW 12 75493476 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATGTGTGCACCTTTATCAATG -3'
(R):5'- ACCACCTGGCAACTTCTTGG -3'

Sequencing Primer
(F):5'- TTATCAATGGCCACAGCATCTGG -3'
(R):5'- ACCTGGCAACTTCTTGGAAGATC -3'
Posted On2014-10-02