Incidental Mutation 'R2181:Gabrr3'
ID237205
Institutional Source Beutler Lab
Gene Symbol Gabrr3
Ensembl Gene ENSMUSG00000074991
Gene Namegamma-aminobutyric acid (GABA) receptor, rho 3
Synonyms
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59407332-59464504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59448009 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 328 (D328E)
Ref Sequence ENSEMBL: ENSMUSP00000109980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114341]
Predicted Effect probably damaging
Transcript: ENSMUST00000114341
AA Change: D328E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109980
Gene: ENSMUSG00000074991
AA Change: D328E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 264 3.8e-55 PFAM
Pfam:Neur_chan_memb 271 426 8.6e-31 PFAM
transmembrane domain 446 463 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter gamma-aminobutyric acid (GABA) functions in the central nervous system to regulate synaptic transmission of neurons. This gene encodes one of three related subunits, which combine as homo- or hetero-pentamers to form GABA(C) receptors. In humans, some individuals contain a single-base polymorphism (dbSNP rs832032) that is predicted to inactivate the gene product. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Gabrr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02816:Gabrr3 APN 16 59440467 splice site probably benign
IGL02989:Gabrr3 APN 16 59448008 missense probably damaging 0.98
IGL03048:Gabrr3 UTSW 16 59430130 missense probably benign 0.00
R0368:Gabrr3 UTSW 16 59440596 missense probably damaging 0.99
R0976:Gabrr3 UTSW 16 59461524 missense probably benign 0.34
R1104:Gabrr3 UTSW 16 59461635 missense probably damaging 0.98
R1231:Gabrr3 UTSW 16 59461400 missense probably benign 0.01
R1556:Gabrr3 UTSW 16 59461400 missense probably benign 0.01
R2185:Gabrr3 UTSW 16 59434668 missense probably damaging 1.00
R2336:Gabrr3 UTSW 16 59429950 missense probably damaging 1.00
R3941:Gabrr3 UTSW 16 59433501 missense probably damaging 1.00
R4572:Gabrr3 UTSW 16 59461638 missense probably benign 0.09
R4747:Gabrr3 UTSW 16 59447914 splice site probably null
R4786:Gabrr3 UTSW 16 59430100 missense probably benign 0.44
R4845:Gabrr3 UTSW 16 59426470 missense probably damaging 0.99
R5539:Gabrr3 UTSW 16 59461395 missense probably benign
R5543:Gabrr3 UTSW 16 59433507 missense probably damaging 1.00
R5979:Gabrr3 UTSW 16 59434568 missense possibly damaging 0.81
R6211:Gabrr3 UTSW 16 59448108 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCGGAGACAGGAGATTGATCTTG -3'
(R):5'- TGCTAAAGAAGTTAGTCTTTGCCC -3'

Sequencing Primer
(F):5'- AGACAGGAGATTGATCTTGTTCTC -3'
(R):5'- GTCAGGGTGTTTTATCACAGCAACAG -3'
Posted On2014-10-02