Incidental Mutation 'R2181:Pglyrp2'
ID237206
Institutional Source Beutler Lab
Gene Symbol Pglyrp2
Ensembl Gene ENSMUSG00000079563
Gene Namepeptidoglycan recognition protein 2
SynonymstagL-alpha, PGRP-L, tagl-beta, tagL, C730002N09Rik, Pglyrpl
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32413100-32424167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32418962 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000129964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114455] [ENSMUST00000170392]
Predicted Effect probably damaging
Transcript: ENSMUST00000114455
AA Change: S31P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110099
Gene: ENSMUSG00000079563
AA Change: S31P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170392
AA Change: S31P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129964
Gene: ENSMUSG00000079563
AA Change: S31P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. This protein hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in bacterial cell wall glycopeptides, and thus may play a scavenger role by digesting biologically active peptidoglycan into biologically inactive fragments. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene are viable and fertile with no gross developmental defects. Mice homozygous for a different knock-out allele are resistant to peptidoglycan- or muramyl dipeptide-induced arthritis and increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Pglyrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Pglyrp2 APN 17 32418577 missense probably benign 0.14
IGL01949:Pglyrp2 APN 17 32416106 splice site probably null
IGL02355:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02362:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02601:Pglyrp2 APN 17 32415861 missense probably benign 0.04
IGL02965:Pglyrp2 APN 17 32418586 missense probably benign 0.00
R0324:Pglyrp2 UTSW 17 32418328 missense probably benign 0.00
R0386:Pglyrp2 UTSW 17 32420862 start codon destroyed probably null 0.93
R2158:Pglyrp2 UTSW 17 32418248 missense probably benign 0.12
R2191:Pglyrp2 UTSW 17 32415957 missense probably benign 0.04
R2313:Pglyrp2 UTSW 17 32418699 missense probably damaging 1.00
R4825:Pglyrp2 UTSW 17 32418261 missense probably benign 0.00
R4852:Pglyrp2 UTSW 17 32415849 missense probably benign 0.09
R4888:Pglyrp2 UTSW 17 32418797 missense probably benign 0.26
R6941:Pglyrp2 UTSW 17 32416074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTGAGGATCTGGCTCTG -3'
(R):5'- AGTGCTCAGACAGTTCTACCTC -3'

Sequencing Primer
(F):5'- AGTGAGGATCTGGCTCTGTAGTG -3'
(R):5'- AGGCAACAGTCTGGGTGC -3'
Posted On2014-10-02