Incidental Mutation 'R2181:Zfp811'
ID237207
Institutional Source Beutler Lab
Gene Symbol Zfp811
Ensembl Gene ENSMUSG00000055202
Gene Namezinc finger protein 811
Synonyms
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32795676-32809853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32797721 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 448 (K448N)
Ref Sequence ENSEMBL: ENSMUSP00000144038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080905] [ENSMUST00000200914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080905
AA Change: K447N

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079709
Gene: ENSMUSG00000055202
AA Change: K447N

DomainStartEndE-ValueType
KRAB 3 62 6.26e-16 SMART
ZnF_C2H2 192 215 1.25e-1 SMART
ZnF_C2H2 220 242 1.79e-2 SMART
ZnF_C2H2 248 270 9.08e-4 SMART
ZnF_C2H2 276 298 7.78e-3 SMART
ZnF_C2H2 304 326 3.69e-4 SMART
ZnF_C2H2 332 354 8.47e-4 SMART
ZnF_C2H2 360 382 1.45e-2 SMART
ZnF_C2H2 388 410 6.42e-4 SMART
ZnF_C2H2 416 438 5.9e-3 SMART
ZnF_C2H2 444 466 1.08e-1 SMART
ZnF_C2H2 472 494 2.75e-3 SMART
ZnF_C2H2 500 522 9.44e-2 SMART
ZnF_C2H2 528 551 3.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104150
Predicted Effect probably damaging
Transcript: ENSMUST00000200914
AA Change: K448N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144038
Gene: ENSMUSG00000055202
AA Change: K448N

DomainStartEndE-ValueType
KRAB 4 63 2.6e-18 SMART
ZnF_C2H2 193 216 5.4e-4 SMART
ZnF_C2H2 221 243 7.8e-5 SMART
ZnF_C2H2 249 271 3.8e-6 SMART
ZnF_C2H2 277 299 3.3e-5 SMART
ZnF_C2H2 305 327 1.6e-6 SMART
ZnF_C2H2 333 355 3.8e-6 SMART
ZnF_C2H2 361 383 6.1e-5 SMART
ZnF_C2H2 389 411 2.7e-6 SMART
ZnF_C2H2 417 439 2.5e-5 SMART
ZnF_C2H2 445 467 4.6e-4 SMART
ZnF_C2H2 473 495 1.2e-5 SMART
ZnF_C2H2 501 523 4e-4 SMART
ZnF_C2H2 529 552 1.7e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Other mutations in Zfp811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp811 APN 17 32797820 missense probably damaging 1.00
IGL02227:Zfp811 APN 17 32798642 nonsense probably null
IGL02529:Zfp811 APN 17 32797815 missense probably damaging 1.00
IGL03190:Zfp811 APN 17 32798881 splice site probably benign
R0112:Zfp811 UTSW 17 32797764 missense probably damaging 0.96
R1025:Zfp811 UTSW 17 32798644 missense probably benign 0.00
R1522:Zfp811 UTSW 17 32797648 missense probably damaging 1.00
R1829:Zfp811 UTSW 17 32798142 missense possibly damaging 0.72
R1861:Zfp811 UTSW 17 32797425 missense probably damaging 1.00
R4360:Zfp811 UTSW 17 32798458 missense probably benign 0.01
R4425:Zfp811 UTSW 17 32797547 nonsense probably null
R4657:Zfp811 UTSW 17 32800923 nonsense probably null
R6066:Zfp811 UTSW 17 32798827 missense possibly damaging 0.73
R6109:Zfp811 UTSW 17 32797374 unclassified probably null
R6702:Zfp811 UTSW 17 32797842 missense probably damaging 1.00
R6714:Zfp811 UTSW 17 32797762 missense probably damaging 1.00
R6826:Zfp811 UTSW 17 32797788 missense probably damaging 1.00
R6983:Zfp811 UTSW 17 32797432 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTCATGGGGTTTCTCTCCG -3'
(R):5'- AGCAATGCGGGAAGGCTTTC -3'

Sequencing Primer
(F):5'- AGTGAATGTTTTGCCACATTGC -3'
(R):5'- GGGAAGGCTTTCACTCGTC -3'
Posted On2014-10-02